ID: 987310035

View in Genome Browser
Species Human (GRCh38)
Location 5:16673182-16673204
Sequence GAAAAAAAAAAAACGTCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5079
Summary {0: 1, 1: 2, 2: 27, 3: 495, 4: 4554}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987310035_987310051 14 Left 987310035 5:16673182-16673204 CCAGATGACGTTTTTTTTTTTTC 0: 1
1: 2
2: 27
3: 495
4: 4554
Right 987310051 5:16673219-16673241 GGGGGTGGGGGTCGGGGTGGTGG 0: 3
1: 152
2: 378
3: 1525
4: 10969
987310035_987310047 7 Left 987310035 5:16673182-16673204 CCAGATGACGTTTTTTTTTTTTC 0: 1
1: 2
2: 27
3: 495
4: 4554
Right 987310047 5:16673212-16673234 AGCCTTGGGGGGTGGGGGTCGGG 0: 1
1: 1
2: 4
3: 73
4: 825
987310035_987310037 -7 Left 987310035 5:16673182-16673204 CCAGATGACGTTTTTTTTTTTTC 0: 1
1: 2
2: 27
3: 495
4: 4554
Right 987310037 5:16673198-16673220 TTTTTTCCATAAGAAGCCTTGGG 0: 1
1: 0
2: 0
3: 26
4: 338
987310035_987310046 6 Left 987310035 5:16673182-16673204 CCAGATGACGTTTTTTTTTTTTC 0: 1
1: 2
2: 27
3: 495
4: 4554
Right 987310046 5:16673211-16673233 AAGCCTTGGGGGGTGGGGGTCGG 0: 1
1: 2
2: 19
3: 142
4: 1075
987310035_987310043 0 Left 987310035 5:16673182-16673204 CCAGATGACGTTTTTTTTTTTTC 0: 1
1: 2
2: 27
3: 495
4: 4554
Right 987310043 5:16673205-16673227 CATAAGAAGCCTTGGGGGGTGGG 0: 1
1: 0
2: 1
3: 16
4: 211
987310035_987310040 -4 Left 987310035 5:16673182-16673204 CCAGATGACGTTTTTTTTTTTTC 0: 1
1: 2
2: 27
3: 495
4: 4554
Right 987310040 5:16673201-16673223 TTTCCATAAGAAGCCTTGGGGGG No data
987310035_987310038 -6 Left 987310035 5:16673182-16673204 CCAGATGACGTTTTTTTTTTTTC 0: 1
1: 2
2: 27
3: 495
4: 4554
Right 987310038 5:16673199-16673221 TTTTTCCATAAGAAGCCTTGGGG No data
987310035_987310052 21 Left 987310035 5:16673182-16673204 CCAGATGACGTTTTTTTTTTTTC 0: 1
1: 2
2: 27
3: 495
4: 4554
Right 987310052 5:16673226-16673248 GGGGTCGGGGTGGTGGTTATTGG 0: 1
1: 0
2: 3
3: 49
4: 466
987310035_987310039 -5 Left 987310035 5:16673182-16673204 CCAGATGACGTTTTTTTTTTTTC 0: 1
1: 2
2: 27
3: 495
4: 4554
Right 987310039 5:16673200-16673222 TTTTCCATAAGAAGCCTTGGGGG 0: 1
1: 0
2: 0
3: 23
4: 235
987310035_987310044 1 Left 987310035 5:16673182-16673204 CCAGATGACGTTTTTTTTTTTTC 0: 1
1: 2
2: 27
3: 495
4: 4554
Right 987310044 5:16673206-16673228 ATAAGAAGCCTTGGGGGGTGGGG 0: 1
1: 0
2: 1
3: 22
4: 235
987310035_987310045 2 Left 987310035 5:16673182-16673204 CCAGATGACGTTTTTTTTTTTTC 0: 1
1: 2
2: 27
3: 495
4: 4554
Right 987310045 5:16673207-16673229 TAAGAAGCCTTGGGGGGTGGGGG No data
987310035_987310042 -1 Left 987310035 5:16673182-16673204 CCAGATGACGTTTTTTTTTTTTC 0: 1
1: 2
2: 27
3: 495
4: 4554
Right 987310042 5:16673204-16673226 CCATAAGAAGCCTTGGGGGGTGG No data
987310035_987310050 11 Left 987310035 5:16673182-16673204 CCAGATGACGTTTTTTTTTTTTC 0: 1
1: 2
2: 27
3: 495
4: 4554
Right 987310050 5:16673216-16673238 TTGGGGGGTGGGGGTCGGGGTGG 0: 1
1: 8
2: 115
3: 849
4: 4019
987310035_987310048 8 Left 987310035 5:16673182-16673204 CCAGATGACGTTTTTTTTTTTTC 0: 1
1: 2
2: 27
3: 495
4: 4554
Right 987310048 5:16673213-16673235 GCCTTGGGGGGTGGGGGTCGGGG 0: 1
1: 1
2: 10
3: 113
4: 1135
987310035_987310036 -8 Left 987310035 5:16673182-16673204 CCAGATGACGTTTTTTTTTTTTC 0: 1
1: 2
2: 27
3: 495
4: 4554
Right 987310036 5:16673197-16673219 TTTTTTTCCATAAGAAGCCTTGG 0: 1
1: 0
2: 3
3: 35
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987310035 Original CRISPR GAAAAAAAAAAAACGTCATC TGG (reversed) Intronic
Too many off-targets to display for this crispr