ID: 987310038 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:16673199-16673221 |
| Sequence | TTTTTCCATAAGAAGCCTTG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 987310035_987310038 | -6 | Left | 987310035 | 5:16673182-16673204 | CCAGATGACGTTTTTTTTTTTTC | 0: 1 1: 2 2: 27 3: 495 4: 4554 |
||
| Right | 987310038 | 5:16673199-16673221 | TTTTTCCATAAGAAGCCTTGGGG | No data | ||||
| 987310034_987310038 | 13 | Left | 987310034 | 5:16673163-16673185 | CCAAGGAACAACAGAGACTCCAG | 0: 1 1: 0 2: 4 3: 30 4: 260 |
||
| Right | 987310038 | 5:16673199-16673221 | TTTTTCCATAAGAAGCCTTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 987310038 | Original CRISPR | TTTTTCCATAAGAAGCCTTG GGG | Intronic | ||
| No off target data available for this crispr | |||||