ID: 987310038

View in Genome Browser
Species Human (GRCh38)
Location 5:16673199-16673221
Sequence TTTTTCCATAAGAAGCCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987310035_987310038 -6 Left 987310035 5:16673182-16673204 CCAGATGACGTTTTTTTTTTTTC 0: 1
1: 2
2: 27
3: 495
4: 4554
Right 987310038 5:16673199-16673221 TTTTTCCATAAGAAGCCTTGGGG No data
987310034_987310038 13 Left 987310034 5:16673163-16673185 CCAAGGAACAACAGAGACTCCAG 0: 1
1: 0
2: 4
3: 30
4: 260
Right 987310038 5:16673199-16673221 TTTTTCCATAAGAAGCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987310038 Original CRISPR TTTTTCCATAAGAAGCCTTG GGG Intronic
No off target data available for this crispr