ID: 987310083

View in Genome Browser
Species Human (GRCh38)
Location 5:16673681-16673703
Sequence CTCCCACACCACCGCTGGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987310083_987310088 -4 Left 987310083 5:16673681-16673703 CCTCCCCAGCGGTGGTGTGGGAG 0: 1
1: 0
2: 1
3: 21
4: 181
Right 987310088 5:16673700-16673722 GGAGTTGATGGTGATCTTGCAGG 0: 1
1: 0
2: 2
3: 45
4: 319
987310083_987310091 23 Left 987310083 5:16673681-16673703 CCTCCCCAGCGGTGGTGTGGGAG 0: 1
1: 0
2: 1
3: 21
4: 181
Right 987310091 5:16673727-16673749 GCCGCCATGGCAATAGACCGTGG 0: 1
1: 0
2: 0
3: 8
4: 86
987310083_987310089 10 Left 987310083 5:16673681-16673703 CCTCCCCAGCGGTGGTGTGGGAG 0: 1
1: 0
2: 1
3: 21
4: 181
Right 987310089 5:16673714-16673736 TCTTGCAGGAGCCGCCGCCATGG 0: 1
1: 0
2: 1
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987310083 Original CRISPR CTCCCACACCACCGCTGGGG AGG (reversed) Exonic
900343076 1:2197747-2197769 CTCCCATGTCACCACTGGGGAGG + Intronic
900531859 1:3157834-3157856 CTCCCCCAGCACCGCCGGGCTGG + Intronic
900548630 1:3242414-3242436 CTCCAGCACCACCACTGGGACGG + Intronic
900602919 1:3510748-3510770 CTGCCACTGCACAGCTGGGGTGG - Intronic
902747006 1:18481111-18481133 TTCCCACCCCACCGCTGGGCTGG - Exonic
906693318 1:47807286-47807308 CTTCCTCACCTCCACTGGGGTGG - Intronic
909059620 1:70865324-70865346 CTTCCTCACTACTGCTGGGGTGG - Intronic
910168013 1:84348360-84348382 CTCCCACACCATCCCCAGGGCGG - Intronic
911973544 1:104464959-104464981 CTCCCCCACCATCTTTGGGGAGG - Intergenic
915537184 1:156543940-156543962 CTCCCTCCCAACAGCTGGGGAGG + Intronic
917092467 1:171367262-171367284 CTCCCAGACCACTGCTTGAGAGG - Intergenic
917738822 1:177944200-177944222 CTCCCACAGGACAGCTGCGGAGG + Intronic
923617144 1:235547302-235547324 ATCAGACACCACCGTTGGGGAGG - Intergenic
924907322 1:248469898-248469920 ATACCACACCACCGCTGCTGGGG + Intergenic
1063243516 10:4194888-4194910 CTCCAACAGCACAGGTGGGGAGG + Intergenic
1063374000 10:5541030-5541052 CTCCCAATCCACCGCTGGGCTGG - Intergenic
1065663648 10:28034666-28034688 ATCCCACACCCATGCTGGGGAGG - Intergenic
1066390224 10:34972319-34972341 CTCCCCCACCATCTTTGGGGAGG + Intergenic
1066534869 10:36380733-36380755 CTTCCAGACCACAGCTGGGAGGG + Intergenic
1067065253 10:43100817-43100839 CTTCCCCCCCACCGCTGGTGTGG + Intronic
1067065254 10:43100820-43100842 CTTCCACACCAGCGGTGGGGGGG - Intronic
1067742748 10:48908242-48908264 CTCCCACACCACCAGGGGTGGGG + Intronic
1069873130 10:71545246-71545268 CTCCCAGGCCACGGCAGGGGAGG + Intronic
1070257853 10:74826367-74826389 CTCCGGCACCACCCCGGGGGAGG - Intronic
1070722898 10:78769041-78769063 CTCCCTCACCACCCCTGGCTAGG + Intergenic
1070736269 10:78865796-78865818 CTGCCACACCACTGGTGGTGGGG - Intergenic
1074078807 10:110151857-110151879 CTCCCAGGCCACAGCTGGAGTGG - Intergenic
1075976900 10:126703932-126703954 GTCCCACTTCACAGCTGGGGAGG + Intergenic
1076235905 10:128863768-128863790 CTGCCATGCCACCACTGGGGTGG - Intergenic
1077468022 11:2742883-2742905 CTGCCACACCACAGGTGTGGGGG - Intronic
1081693414 11:45093647-45093669 CTCCCACACCGCCGCTTCTGTGG - Intergenic
1083737317 11:64688830-64688852 CTCCCAGACCTCCTCTGGGAAGG + Intronic
1084244903 11:67850371-67850393 CTCCCCCACCATCTTTGGGGAGG - Intergenic
1084261311 11:67980559-67980581 CTCCCCCACCATCTTTGGGGAGG - Intergenic
1084968466 11:72756560-72756582 CACCCACAGCACCCCTGGAGGGG + Intronic
1088531862 11:110819299-110819321 CTCCGATACCAGGGCTGGGGTGG + Intergenic
1088739780 11:112757731-112757753 CACACACACCACAGCTGGGTGGG + Intergenic
1091683049 12:2540552-2540574 CTCTCACACCACAGCAGTGGAGG - Intronic
1095990265 12:48029645-48029667 CCCCCACAGCCCCTCTGGGGTGG + Intergenic
1096243947 12:49974101-49974123 CTCCCACCCCACCAGTGGGTTGG - Intronic
1096484690 12:51971003-51971025 CTCCCACACCCCTCCTGGTGAGG + Intronic
1096496121 12:52040401-52040423 CTACCACCCCACTGCTGAGGAGG - Intronic
1098892156 12:76020405-76020427 TTTCAACACCACCGCTGGAGGGG - Intergenic
1101799540 12:108008752-108008774 CCCACACCCCACCTCTGGGGAGG - Intergenic
1104292726 12:127484356-127484378 CTCCCTCACCATCTTTGGGGAGG + Intergenic
1107430270 13:40334230-40334252 CTGCCCCACCTCTGCTGGGGTGG - Intergenic
1108779268 13:53808585-53808607 CCCTCACACAACCTCTGGGGCGG + Intergenic
1111267327 13:85834191-85834213 CTCCCCCACCACAGCTGGATAGG - Intergenic
1114152897 14:20064566-20064588 CTTCCAGACCACAGCTGGGAGGG - Intergenic
1114393140 14:22331697-22331719 CTCCCACCCCACTGCTGGGAGGG - Intergenic
1115709923 14:36039474-36039496 CTCCCACACCAGGCCTTGGGAGG + Intergenic
1117038605 14:51750560-51750582 CTCCCCCACCACCTTCGGGGAGG + Intergenic
1117253234 14:53955102-53955124 GTCCCGCGCCACCGCTGGGGCGG + Intronic
1120476280 14:84991947-84991969 CTTCCACTCCACCGTGGGGGCGG - Intergenic
1122721559 14:103725231-103725253 CTCCCAAACCTCAGCTGGGAAGG - Intronic
1123716923 15:23040196-23040218 CTCCCCCACCACCTCTGGCCAGG - Intergenic
1124158018 15:27245142-27245164 CTCCCACACCGCAGCAGAGGAGG - Intronic
1132730089 16:1356843-1356865 CTCTCACACTCCCGCTGGGAGGG - Intronic
1133018348 16:2955145-2955167 CCCCCACCCCCCCGCAGGGGTGG - Intergenic
1134261508 16:12654844-12654866 CTCCCCCAGCACCGCCGGGTGGG - Intergenic
1135479832 16:22813718-22813740 CCCCCACACCCACGCGGGGGTGG - Intergenic
1137389205 16:48067492-48067514 CTCCCACACCACCCTTTGGGTGG + Intergenic
1137831225 16:51545260-51545282 CTCCCCCACCACAGCTGCGGGGG - Intergenic
1140224417 16:73066676-73066698 TTTCCAGACCACTGCTGGGGCGG - Intergenic
1141078965 16:81034385-81034407 CTCCCCCTCAACCTCTGGGGAGG - Intergenic
1145237805 17:21221420-21221442 CTCCCCCAGCACCCCTGTGGTGG + Intergenic
1145865036 17:28235721-28235743 CTCCCCCACCATCTTTGGGGAGG - Intergenic
1147156125 17:38545265-38545287 CTCCCCCACTACCCCTGGTGGGG + Intronic
1147178570 17:38671568-38671590 CTCCCACAACACAGCTGGAGGGG + Intergenic
1147412627 17:40264706-40264728 CTCCCCCACCACCCCCAGGGCGG + Exonic
1147741103 17:42671350-42671372 CTCCCACACCACGGCGGGGGAGG - Exonic
1147753221 17:42750157-42750179 CTCCAACCCCACAGCTAGGGTGG + Intergenic
1148414963 17:47499287-47499309 CTCCCACACCACGTTTAGGGAGG + Intergenic
1149075950 17:52596290-52596312 CTCCCCCACCATCTTTGGGGAGG + Intergenic
1149527248 17:57366284-57366306 GTCCGAGACCACCGGTGGGGTGG + Intronic
1149961874 17:61118532-61118554 CTCCAACACCACCCCTGTGGAGG + Intronic
1152633879 17:81422687-81422709 CTCCCACACCACATCAGGTGGGG - Intronic
1157597211 18:48871145-48871167 CTCCAACACCATGGCTGAGGGGG - Intergenic
1157614513 18:48978632-48978654 CTCCAACACCATGGCTGAGGGGG + Intergenic
1158634863 18:59147767-59147789 CTCCCAGACCTCTGCTGAGGAGG - Intronic
1159965299 18:74589156-74589178 CTCCCTCACCCCCGCTGATGTGG + Intergenic
1160796760 19:949236-949258 CACCCACGCCGCCGCTGGGAGGG - Intronic
1160908039 19:1460913-1460935 AGCCCACCACACCGCTGGGGAGG - Intronic
1160981265 19:1817635-1817657 ACCCCACACCAACGATGGGGAGG + Intronic
1161081554 19:2312979-2313001 CTCCCACCCCACCGCCTGGGAGG + Intronic
1161313477 19:3607324-3607346 CTCCCACCCCACCCCTGGAAGGG - Intergenic
1161320230 19:3637677-3637699 CTCCCACCCGACCACGGGGGTGG - Intronic
1163719098 19:18889875-18889897 CTTTCACACCACCTCTAGGGTGG + Intronic
1163721610 19:18900545-18900567 GTCCCACCCCACCTCTGAGGAGG - Intronic
1163966551 19:20752017-20752039 CTCCCCCACCATCTTTGGGGAGG - Intronic
1164679465 19:30124083-30124105 TCCCCACACCCCCGCTGGAGGGG - Intergenic
1165312050 19:35034323-35034345 CTCACTCAACACCTCTGGGGCGG + Intronic
1165326046 19:35115268-35115290 CCCCAACACCACCGTGGGGGCGG - Intergenic
1166544487 19:43625955-43625977 CTCCCTCACCACAGCTTGGGAGG + Exonic
925312227 2:2893047-2893069 CTCCCTCACCAGCACTGTGGTGG + Intergenic
925730466 2:6917021-6917043 CTCCCCGACCCTCGCTGGGGCGG - Intergenic
925939739 2:8805335-8805357 CTAACCCACCACCTCTGGGGAGG - Intronic
925981348 2:9179978-9180000 CTCCCACAACAGTGCTGGGGAGG - Intergenic
926406165 2:12555113-12555135 CTCCCACACCACTGCCAGGCAGG - Intergenic
926445434 2:12935985-12936007 TTCCCACTGCACCGCTGGGTGGG - Intergenic
934847895 2:97674149-97674171 CTGCCACACAAGCACTGGGGAGG - Intergenic
934941508 2:98506416-98506438 CTCACACCACACCGCTGGGCTGG - Intronic
937638438 2:124184298-124184320 CGCCCACCCCAAAGCTGGGGAGG - Intronic
942218334 2:173744683-173744705 CTCCCAAACCACCACATGGGGGG - Intergenic
946401169 2:219469093-219469115 CTCCCACCCCAGGGCTGGGCTGG - Intronic
946403942 2:219483159-219483181 CACCCACACCCGCTCTGGGGGGG - Exonic
947605067 2:231480918-231480940 ATCCCACCCCAGCCCTGGGGAGG - Intronic
947751183 2:232533430-232533452 CTCCCACATCACCCATGGTGCGG - Intronic
948887677 2:240892274-240892296 CTCCCACTCCAGAGCTGGAGAGG + Intronic
949009417 2:241670061-241670083 CTCCTACACCAGCGCCGAGGCGG + Intronic
1169910142 20:10641573-10641595 CGCCCACACCAGTGCAGGGGTGG + Exonic
1170392666 20:15892132-15892154 CTCCCAGAGCACAGCAGGGGTGG + Intronic
1170529898 20:17280840-17280862 CTCCCACACCAACCATGTGGAGG + Intronic
1172506392 20:35466025-35466047 CTCTCACACCTGCACTGGGGAGG - Exonic
1172840180 20:37898086-37898108 CTCCCGCCCCACCACTGTGGTGG - Intergenic
1174270437 20:49364553-49364575 CTCACACACGACCCATGGGGGGG - Exonic
1174296337 20:49547951-49547973 CTCCCACACCACCGCGTCGTAGG + Exonic
1175902231 20:62364545-62364567 CTCCCCCACCTCCGCTGCGGAGG + Intronic
1178566934 21:33695178-33695200 CTCTCACACCACTGGTGGGAGGG - Intronic
1179057873 21:37952691-37952713 CTCCCCCTGCACCGCTGGTGTGG - Intronic
1180131048 21:45827276-45827298 CTCCGACACCATCGCAGCGGGGG - Intronic
1180953007 22:19729197-19729219 GTGCCAGGCCACCGCTGGGGAGG - Intergenic
1181452290 22:23031588-23031610 GTCCCACAGCATTGCTGGGGTGG - Intergenic
1182127095 22:27824024-27824046 CTCCCACACCACCTCTTGAGAGG - Intergenic
1183080490 22:35452718-35452740 GTCCGACTCCTCCGCTGGGGTGG + Intergenic
1183617452 22:38954321-38954343 CCCCCATACCCCCACTGGGGTGG - Intronic
1185052892 22:48563000-48563022 CTCCCACACCAGAGCTGGGCTGG + Intronic
1185086502 22:48743720-48743742 CTCCCCCAACACAGCTGGGCTGG - Intronic
1185315379 22:50176754-50176776 CCCCCACACCACCGTGGTGGGGG + Intronic
1185377686 22:50489658-50489680 CTCCCACAACACCCCTCGGCGGG - Intronic
949157921 3:849901-849923 CTCCCCCACCATCTTTGGGGGGG + Intergenic
950568736 3:13787235-13787257 CTCCCAGACCGTGGCTGGGGTGG + Intergenic
952966156 3:38622528-38622550 CCACGCCACCACCGCTGGGGGGG + Intronic
954651755 3:52168921-52168943 CTCCCATAGCATTGCTGGGGTGG - Intergenic
957022327 3:75139736-75139758 CTCCCCCACCATCTTTGGGGAGG + Intergenic
962743726 3:138382077-138382099 CTCCCACATCACTGCTGGCAGGG - Intronic
962922712 3:139965420-139965442 CTCCCACATTACCCCTGGAGAGG - Intronic
967000240 3:185327229-185327251 CTCCCTGACCACAGCTGGGAGGG + Intronic
968047112 3:195630703-195630725 CTCACACATCATCACTGGGGTGG - Intergenic
968307536 3:197659341-197659363 CTCACACATCATCACTGGGGTGG + Intergenic
968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG + Intergenic
968562929 4:1294589-1294611 CTCTCAGACCACTGCTGCGGAGG - Intronic
969373167 4:6746956-6746978 CTCCCACAGCTCAGCTGGGAGGG - Intergenic
969607606 4:8210310-8210332 CCCCCAACCCCCCGCTGGGGAGG + Intronic
972532932 4:39977165-39977187 CTCCCTCACCCCCGCGGGAGGGG + Intronic
985970385 5:3373552-3373574 CTACCAGACCACAGCTGGGAGGG + Intergenic
986131474 5:4936098-4936120 CTCCATCAGCAGCGCTGGGGCGG + Intergenic
986487888 5:8258728-8258750 CTCACACAGCAACACTGGGGAGG + Intergenic
986989919 5:13539723-13539745 CTCCCAGACCACAGCTGGCCAGG - Intergenic
987310083 5:16673681-16673703 CTCCCACACCACCGCTGGGGAGG - Exonic
998266902 5:140673375-140673397 CTCTCACACCACAGCTGAGAGGG + Exonic
998821270 5:146059995-146060017 CTCCACCACCACGGCTGAGGGGG - Exonic
1001447061 5:171793956-171793978 GGCCCACACCAGCACTGGGGGGG - Intronic
1002098965 5:176848022-176848044 TTCCCACACCAGACCTGGGGGGG + Intronic
1003273283 6:4625677-4625699 GTCTCACACCTCCCCTGGGGAGG + Intergenic
1003942929 6:11045539-11045561 CTCCCACACCGCCCCAGGTGTGG - Intergenic
1007038855 6:38702923-38702945 CTCCCCCAGCTCCGCTGGGCCGG - Intronic
1007361244 6:41358059-41358081 CTCCCACTCCCACGCTGGAGTGG + Intergenic
1012937574 6:105384163-105384185 CCCCCAGACCACGGCTGGGCAGG + Intronic
1013225940 6:108119471-108119493 CTGCCACGCCTGCGCTGGGGTGG - Intronic
1014143017 6:117965614-117965636 TTCCCACCCCACAGCTGGGGTGG + Intronic
1016516000 6:144893532-144893554 CTTCCACCCCACCTCTCGGGGGG + Intergenic
1018736018 6:166687927-166687949 CCCCCAGACCACCACTGGGGAGG + Intronic
1019176813 6:170163985-170164007 CACACACACCAGCGCTGTGGGGG + Intergenic
1019259492 7:72899-72921 CACCCACACCTCCCCTGGGCCGG - Intergenic
1019342723 7:516167-516189 CTCCCACAGCACAGCTGGGCGGG - Intronic
1019406183 7:885465-885487 CTCCCAGAGCACCGCTGGCAGGG - Intronic
1019486510 7:1291970-1291992 CTCGCGCACAACTGCTGGGGAGG - Intergenic
1019698501 7:2460948-2460970 CTCTAACCCCACAGCTGGGGAGG - Intergenic
1020279800 7:6644342-6644364 CTCCCACACCCCTGCTCTGGAGG - Intronic
1021027241 7:15685559-15685581 CTCCCTCCCCAGCGCTGGGATGG + Intronic
1021027243 7:15685562-15685584 CTTCCATCCCAGCGCTGGGGAGG - Intronic
1027420645 7:78014744-78014766 CTGTCCCACCACCCCTGGGGAGG - Intergenic
1032333502 7:131002507-131002529 CTCCCACACCAACTCTGGACTGG + Intergenic
1034953025 7:155313726-155313748 CTCGCACACCACTCCTGGGCTGG - Intergenic
1035252508 7:157606336-157606358 CCCCCACCCCCACGCTGGGGAGG - Intronic
1037262817 8:17027248-17027270 CGCCCACACCAGAGCTGGGAGGG - Exonic
1038010951 8:23475407-23475429 CTCCCACGCCTCCTCTGGGGTGG + Intergenic
1038010963 8:23475468-23475490 CTCCCACGCCTCCTCTGGGGTGG + Intergenic
1042606413 8:70550929-70550951 ATCCCAGACCACCTGTGGGGAGG + Intergenic
1049195461 8:141313268-141313290 CCCCCACCCCACCGCTGTGTAGG - Intergenic
1049792085 8:144476773-144476795 CCCCCACACCCCCGGTCGGGTGG + Intergenic
1051897645 9:22005605-22005627 CTCCCACTCCAGCGCTGAGTGGG - Exonic
1053210004 9:36219631-36219653 GTCCACCACCACCCCTGGGGAGG + Intronic
1059277438 9:113108329-113108351 CACGCACACCTGCGCTGGGGAGG + Intergenic
1059278813 9:113116222-113116244 CACGCACACCTGCGCTGGGGAGG - Intergenic
1059948365 9:119436342-119436364 CTCCCCCACCAGCCTTGGGGTGG - Intergenic
1060104732 9:120866528-120866550 CTCCCACAGCAACCCTGGGCAGG + Intronic
1061754313 9:132802252-132802274 CTCCCACACCACACCGGGGAAGG - Intronic
1061961248 9:133990438-133990460 TTCCCAAACCACAGCTGGGGAGG + Intronic
1062221629 9:135419205-135419227 GTCACACACCACCCCTGTGGGGG + Intergenic
1062407722 9:136404841-136404863 CTCTCAGACCACCCCTGGGAAGG + Intronic
1062535845 9:137020803-137020825 CCCCAACGCCACCGCTGAGGAGG - Exonic
1062745210 9:138207564-138207586 CACCCACACCTCCCCTGGGCCGG + Intergenic
1203494615 Un_GL000224v1:139385-139407 CACTCAGACCACCCCTGGGGTGG - Intergenic
1203507234 Un_KI270741v1:81260-81282 CACTCAGACCACCCCTGGGGTGG - Intergenic
1189409247 X:40755363-40755385 TTCCCAGACCACAGCTGGGAGGG + Intergenic
1190879605 X:54483246-54483268 CTCCCACACCCGCGCGGTGGGGG + Intronic
1192208063 X:69109197-69109219 CCCCCACACCGCCCCTGGCGGGG - Intergenic
1193083703 X:77429505-77429527 CTCCCCTACCACCTCTGGGCTGG - Intergenic
1200073680 X:153541011-153541033 CCTCCACACTACCGCTGAGGGGG - Intronic
1200158595 X:153992309-153992331 CTCCCTCACCACCGCTGTCTCGG + Intergenic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic
1202037127 Y:20646767-20646789 CTCCCCCACCATCTTTGGGGAGG + Intergenic