ID: 987318266

View in Genome Browser
Species Human (GRCh38)
Location 5:16744525-16744547
Sequence CCAGGGTGTCGGGGTGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987318266_987318277 -1 Left 987318266 5:16744525-16744547 CCCAGAGCACCCCGACACCCTGG No data
Right 987318277 5:16744547-16744569 GGTCTCAGCAGGCGCGGCGCAGG 0: 1
1: 1
2: 0
3: 4
4: 105
987318266_987318279 16 Left 987318266 5:16744525-16744547 CCCAGAGCACCCCGACACCCTGG No data
Right 987318279 5:16744564-16744586 CGCAGGGCTTCCTGTGCCCTTGG 0: 1
1: 0
2: 2
3: 33
4: 334
987318266_987318278 0 Left 987318266 5:16744525-16744547 CCCAGAGCACCCCGACACCCTGG No data
Right 987318278 5:16744548-16744570 GTCTCAGCAGGCGCGGCGCAGGG 0: 1
1: 0
2: 1
3: 6
4: 89
987318266_987318280 22 Left 987318266 5:16744525-16744547 CCCAGAGCACCCCGACACCCTGG No data
Right 987318280 5:16744570-16744592 GCTTCCTGTGCCCTTGGTGCAGG No data
987318266_987318274 -7 Left 987318266 5:16744525-16744547 CCCAGAGCACCCCGACACCCTGG No data
Right 987318274 5:16744541-16744563 ACCCTGGGTCTCAGCAGGCGCGG 0: 1
1: 0
2: 1
3: 12
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987318266 Original CRISPR CCAGGGTGTCGGGGTGCTCT GGG (reversed) Intronic