ID: 987330066

View in Genome Browser
Species Human (GRCh38)
Location 5:16848672-16848694
Sequence CGCTACGGATGGACGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 27}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987330058_987330066 -7 Left 987330058 5:16848656-16848678 CCTGGCGATACCTCCCCGCTACG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 987330066 5:16848672-16848694 CGCTACGGATGGACGGCAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 27
987330057_987330066 6 Left 987330057 5:16848643-16848665 CCATTAGTAAACACCTGGCGATA 0: 1
1: 0
2: 0
3: 2
4: 45
Right 987330066 5:16848672-16848694 CGCTACGGATGGACGGCAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987330066 Original CRISPR CGCTACGGATGGACGGCAGA AGG Intronic
901266498 1:7914383-7914405 CACCATGGATGGACGGCAAAAGG - Intergenic
1072615499 10:97046688-97046710 CGCTCCGGATGGACTCCAGCTGG + Exonic
1091847199 12:3666425-3666447 AGCTAAGGATGGGAGGCAGATGG + Intronic
1101921556 12:108937373-108937395 CCCTACAGATGCACGGGAGATGG + Intronic
1101985570 12:109443925-109443947 CGCTAGGGGAGGAGGGCAGATGG - Intronic
1115665584 14:35541631-35541653 CACTGCAGATGGATGGCAGAAGG + Intronic
1126961160 15:53995956-53995978 TGCTATGGAAGGACGGCCGAAGG + Intergenic
1136786794 16:32939694-32939716 TGCTACAGGTGGAGGGCAGAAGG + Intergenic
1136882978 16:33914096-33914118 TGCTACAGGTGGAGGGCAGAAGG - Intergenic
1141282957 16:82645351-82645373 CACCACGGATAGACGTCAGAAGG - Intronic
1141965398 16:87438809-87438831 CGCTACAGAGGAACAGCAGAGGG + Intronic
1203089030 16_KI270728v1_random:1201364-1201386 TGCTACAGGTGGAGGGCAGAAGG + Intergenic
1143950024 17:10625003-10625025 GGCTCCGGATGGACAGCAGTTGG + Intergenic
1165778960 19:38421054-38421076 AGCTATGGGTGGAGGGCAGAGGG - Intronic
1168340683 19:55621588-55621610 CGCTAGTGATGGAGAGCAGAGGG - Exonic
926149355 2:10416021-10416043 ACCCACAGATGGACGGCAGAAGG - Intronic
928941678 2:36733243-36733265 CCCTCCGGTTGGACTGCAGATGG + Intronic
932768049 2:74483486-74483508 CGCGACGGATGGGCGCCAGACGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
968603981 4:1522872-1522894 TGCTAGGGATGGAGGGCAGATGG - Intergenic
987330066 5:16848672-16848694 CGCTACGGATGGACGGCAGAAGG + Intronic
989581684 5:43039577-43039599 CGCCACGGCTGGAGGGCAGGAGG + Exonic
996419721 5:123249041-123249063 AGCTACTGATGGAGGGGAGAGGG + Intergenic
1005140485 6:22626234-22626256 CGCTGCCTATGGACTGCAGACGG + Intergenic
1019411283 7:907912-907934 GGCCACGGATGCTCGGCAGACGG - Intronic
1021962411 7:25885970-25885992 CGGAACGGATGGATGGCAGATGG + Intergenic
1022273539 7:28833858-28833880 CTCTACGGATGGATGGCGGATGG - Intergenic
1024626612 7:51213319-51213341 CACTGCGGTTGGACGGGAGATGG - Intronic
1040707251 8:50144259-50144281 GGCCACAGATGGAAGGCAGATGG + Intronic
1044535521 8:93352937-93352959 CTCTGGGGATGGACGGCAAAGGG - Intergenic
1200146317 X:153928122-153928144 CGCCGGGGACGGACGGCAGAGGG + Intronic
1201333757 Y:12856860-12856882 GGCTACCAATGGACAGCAGATGG + Intronic