ID: 987331748

View in Genome Browser
Species Human (GRCh38)
Location 5:16863286-16863308
Sequence TGGGCTTCTCCCCAGTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 211}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987331748_987331764 28 Left 987331748 5:16863286-16863308 CCCACCCACTGGGGAGAAGCCCA 0: 1
1: 0
2: 0
3: 22
4: 211
Right 987331764 5:16863337-16863359 GAAGGCAAAAGCCATGTTCTAGG No data
987331748_987331761 6 Left 987331748 5:16863286-16863308 CCCACCCACTGGGGAGAAGCCCA 0: 1
1: 0
2: 0
3: 22
4: 211
Right 987331761 5:16863315-16863337 CAGTCCAAAGGGGCTGGGGTGGG No data
987331748_987331752 -6 Left 987331748 5:16863286-16863308 CCCACCCACTGGGGAGAAGCCCA 0: 1
1: 0
2: 0
3: 22
4: 211
Right 987331752 5:16863303-16863325 AGCCCAGCTGTTCAGTCCAAAGG 0: 1
1: 0
2: 3
3: 12
4: 145
987331748_987331758 1 Left 987331748 5:16863286-16863308 CCCACCCACTGGGGAGAAGCCCA 0: 1
1: 0
2: 0
3: 22
4: 211
Right 987331758 5:16863310-16863332 CTGTTCAGTCCAAAGGGGCTGGG No data
987331748_987331757 0 Left 987331748 5:16863286-16863308 CCCACCCACTGGGGAGAAGCCCA 0: 1
1: 0
2: 0
3: 22
4: 211
Right 987331757 5:16863309-16863331 GCTGTTCAGTCCAAAGGGGCTGG 0: 1
1: 0
2: 2
3: 8
4: 116
987331748_987331753 -5 Left 987331748 5:16863286-16863308 CCCACCCACTGGGGAGAAGCCCA 0: 1
1: 0
2: 0
3: 22
4: 211
Right 987331753 5:16863304-16863326 GCCCAGCTGTTCAGTCCAAAGGG 0: 1
1: 0
2: 1
3: 13
4: 104
987331748_987331760 5 Left 987331748 5:16863286-16863308 CCCACCCACTGGGGAGAAGCCCA 0: 1
1: 0
2: 0
3: 22
4: 211
Right 987331760 5:16863314-16863336 TCAGTCCAAAGGGGCTGGGGTGG 0: 1
1: 0
2: 5
3: 36
4: 450
987331748_987331755 -4 Left 987331748 5:16863286-16863308 CCCACCCACTGGGGAGAAGCCCA 0: 1
1: 0
2: 0
3: 22
4: 211
Right 987331755 5:16863305-16863327 CCCAGCTGTTCAGTCCAAAGGGG 0: 1
1: 1
2: 2
3: 7
4: 117
987331748_987331759 2 Left 987331748 5:16863286-16863308 CCCACCCACTGGGGAGAAGCCCA 0: 1
1: 0
2: 0
3: 22
4: 211
Right 987331759 5:16863311-16863333 TGTTCAGTCCAAAGGGGCTGGGG 0: 1
1: 0
2: 1
3: 12
4: 183
987331748_987331763 10 Left 987331748 5:16863286-16863308 CCCACCCACTGGGGAGAAGCCCA 0: 1
1: 0
2: 0
3: 22
4: 211
Right 987331763 5:16863319-16863341 CCAAAGGGGCTGGGGTGGGAAGG 0: 1
1: 1
2: 12
3: 131
4: 982

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987331748 Original CRISPR TGGGCTTCTCCCCAGTGGGT GGG (reversed) Intronic
900078631 1:837925-837947 TGTGCTTGTCCTCAGAGGGTGGG + Intergenic
901988181 1:13092197-13092219 TGGGTTTCCCCCCAGTGGGAGGG + Intergenic
901993631 1:13134570-13134592 TGGGTTTCCCCCCAGTGGGAGGG - Intergenic
902342935 1:15796153-15796175 AGGGGTTCTGCCCAGTGGATGGG + Intergenic
902361182 1:15943424-15943446 AGGGCTTCTCCCCGGTGTGCTGG + Exonic
902618726 1:17638293-17638315 TGGGCCTCTACCCAGTGTGGAGG + Intronic
906126833 1:43432063-43432085 TGGGTTTCTTTCCAGTGAGTTGG - Intronic
906192966 1:43910569-43910591 TGGGTTTCTGCCCAGTGGGCAGG - Intronic
906745677 1:48220775-48220797 AGGGCTTCTCCCTCATGGGTGGG - Intergenic
906802343 1:48749037-48749059 TGGGCTTCTCCCCCTTGGAAAGG - Intronic
909421879 1:75476252-75476274 TTGGCTGCTCCCCAGTTAGTAGG - Intronic
910260126 1:85285901-85285923 ATGGCTTCTCCCCAGTGAGAGGG - Intergenic
912208789 1:107535999-107536021 TGGGCTTCTGCTCAGGAGGTGGG - Intergenic
915244462 1:154546565-154546587 GGGGCTTGTGCCCAGTGGGCAGG + Intronic
916143906 1:161723362-161723384 TGGGCTTCTCCAGAGTAGCTGGG - Exonic
917179378 1:172278592-172278614 TTGCCTTCTCCCCAGTGGCATGG - Intronic
917738107 1:177938655-177938677 TGAGCCTCTAGCCAGTGGGTTGG + Intronic
919796762 1:201325561-201325583 TGGGGTTGTGCCCACTGGGTAGG + Intronic
1062888608 10:1038685-1038707 TGGGCTTGTCCCCAGGGAGCAGG + Intergenic
1063371551 10:5525777-5525799 TCTGCTTCTCCCGAGTGGGGAGG - Exonic
1063569907 10:7205861-7205883 TGGACATCTTCCCAGTGGGCTGG - Exonic
1063965757 10:11344638-11344660 TGTGCTGCTTCTCAGTGGGTTGG + Intergenic
1064963926 10:20996236-20996258 AGGCCTTTTCCCCAGGGGGTAGG + Intronic
1065296281 10:24278148-24278170 TGTGCTTCTCCACAGTGTTTTGG - Intronic
1065972647 10:30817753-30817775 TGGCCCTCTCCCCAGTGGGGGGG - Intergenic
1066552459 10:36574437-36574459 TGGGCTTCTTCCCATTTGGCTGG + Intergenic
1066689288 10:38010780-38010802 TGGGGTAAGCCCCAGTGGGTTGG + Exonic
1069829453 10:71273644-71273666 TAGGCTTCTTCCCAGGGGCTGGG - Intronic
1070989481 10:80718924-80718946 TGGGCTTATCCCCACATGGTGGG + Intergenic
1071779318 10:88825492-88825514 GGGGCCTCTCATCAGTGGGTTGG + Intronic
1073117250 10:101098207-101098229 TGCGCTTCTCCTTAGTGGGAAGG + Intronic
1073642446 10:105266811-105266833 AGGGCTTCTCACCAGTGGTGAGG + Intergenic
1075709553 10:124523295-124523317 GGGGTTTCCCCCCAGTGGGGTGG + Intronic
1076135745 10:128044969-128044991 TGTGCTTGGCCCCAGTGGGCTGG + Intronic
1076674857 10:132142511-132142533 TGGGGTGCTGCCCAGTGGGGAGG - Intronic
1077318195 11:1928503-1928525 TGGGCTCCTGGCCTGTGGGTGGG + Intronic
1080275829 11:30502554-30502576 TGGCCTTCTCTTCACTGGGTAGG - Intronic
1081569372 11:44280064-44280086 CGACTTTCTCCCCAGTGGGTAGG - Intronic
1084418511 11:69048805-69048827 TGGGGTTCTCCTGAGTGGGGCGG - Intergenic
1084652095 11:70495374-70495396 TGGGCTTCTCCCCCTTGACTTGG + Intronic
1085333538 11:75672105-75672127 TGTCTTTCTCCCCATTGGGTAGG + Intergenic
1085502205 11:77034493-77034515 TGGGCTTCTTCCTATTGGGAAGG + Intronic
1088821076 11:113457924-113457946 AGGGCTGTTCCCCAGTGGGTGGG + Intronic
1090943969 11:131413375-131413397 GCGGCTTCACCACAGTGGGTGGG - Intronic
1096840306 12:54375807-54375829 TGCTCATCTACCCAGTGGGTGGG - Intronic
1097958827 12:65512980-65513002 TGAGCTTTTCCCCAGTGGGAAGG + Intergenic
1098667696 12:73184328-73184350 TGGGCTTTTTTTCAGTGGGTAGG + Intergenic
1101036546 12:100713183-100713205 TGGCCTTCTCCAATGTGGGTAGG - Intergenic
1101199688 12:102421501-102421523 TTGGCTTCTCTCTTGTGGGTGGG + Intronic
1101326097 12:103717162-103717184 TGGGCTTCAGCCCAGTGGCCGGG + Intronic
1102761583 12:115390739-115390761 TGGTCCTCTCCCTGGTGGGTAGG - Intergenic
1103322823 12:120101784-120101806 TGGGTTTTTCCCCAGGGGCTTGG - Intronic
1103700819 12:122847953-122847975 TGTGCTTCTCCCCCTTGGGGTGG + Intronic
1105539073 13:21298640-21298662 TGGTCTTCTCCCCAGAGTGTTGG + Intergenic
1105635957 13:22215569-22215591 TGGAATTCTCACCAGTGGCTTGG + Intergenic
1105696832 13:22897600-22897622 TGGGCTCCTCCCCAGTGGTAGGG + Intergenic
1105835607 13:24208527-24208549 TTGGCTTTTCTCCAGTGGATCGG + Intronic
1105927169 13:25018585-25018607 TGGGCTTCGGCCCAGGGTGTAGG - Intergenic
1106122427 13:26871705-26871727 TGGCCTTCTCCCCAGGGTCTGGG - Intergenic
1106587509 13:31070058-31070080 CTGCCTCCTCCCCAGTGGGTGGG - Intergenic
1109437459 13:62324558-62324580 TGGGCTTTTCCCCCTTGGCTTGG - Intergenic
1110804326 13:79736744-79736766 AGTGCTTCTCCTCACTGGGTGGG - Intergenic
1112496357 13:99908243-99908265 TGGGCCTCTGCCCAGAGGGAAGG - Intergenic
1116898267 14:50338150-50338172 TGGGCTTCCCCCATTTGGGTTGG + Intronic
1120931408 14:89852449-89852471 TGGGCTGCTCCCCAGGGGAGGGG - Intronic
1121261850 14:92572187-92572209 TGGGCTTCTTCCCCTGGGGTGGG + Intronic
1121687460 14:95847764-95847786 TGGGCTTCTCCCCTGTGTCTGGG + Intergenic
1121915264 14:97832535-97832557 GGGGCTTCTCCCGAGTGCCTGGG + Intergenic
1122494734 14:102144813-102144835 TGGGCTACTCCCGAGTAGCTGGG + Intronic
1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG + Intronic
1129667993 15:77590216-77590238 TGGCCCTCTCCCCAGAGTGTTGG - Intergenic
1129929502 15:79398663-79398685 TGGCCTTCCCCACTGTGGGTGGG - Intronic
1130112116 15:80974064-80974086 GGTTCTTCTCCCCAGTGGGGGGG - Intronic
1131271569 15:90950422-90950444 TGGGCTTCTCCCTGCAGGGTTGG + Intronic
1132870041 16:2111920-2111942 GGGGCTTCTGCCGAGCGGGTGGG - Intronic
1132973262 16:2699209-2699231 GGAGCTGCTCCCCAGTGGGCGGG - Intronic
1134166044 16:11930408-11930430 TGGGCGTTTCCCAAGAGGGTGGG + Intronic
1134494675 16:14723319-14723341 TGGGCGTTTCCCAAGAGGGTGGG - Intronic
1134500058 16:14762439-14762461 TGGGCGTTTCCCAAGAGGGTGGG - Intronic
1134522498 16:14925030-14925052 GGGGCTTCTGCCGAGCGGGTGGG + Intronic
1134526599 16:14949057-14949079 TGGGCGTTTCCCAAGAGGGTGGG - Intronic
1134545803 16:15107288-15107310 TGGGCGTTTCCCAAGAGGGTGGG + Intronic
1134580522 16:15366611-15366633 TGGGCGTTTCCCAAGAGGGTGGG + Intronic
1134710168 16:16323681-16323703 GGGGCTTCTGCCGAGCGGGTGGG + Intergenic
1134714177 16:16347530-16347552 TGGGCGTTTCCCAAGAGGGTGGG - Intergenic
1134717382 16:16363681-16363703 GGGGCTTCTGCCGAGCGGGTGGG + Intergenic
1134722051 16:16390894-16390916 TGGGCGTTTCCCAAGAGGGTGGG - Intronic
1134945376 16:18320975-18320997 TGGGCGTTTCCCAAGAGGGTGGG + Intronic
1134949435 16:18344964-18344986 GGGGCTTCTGCCGAGCGGGTGGG - Intergenic
1134952640 16:18361128-18361150 TGGGCGTTTCCCAAGAGGGTGGG + Intergenic
1134957370 16:18388478-18388500 GGGGCTTCTGCCGAGCGGGTGGG - Intergenic
1135111829 16:19696309-19696331 TGGATTTCTCCCCACTGAGTGGG + Intronic
1135218578 16:20593696-20593718 TCGGCTTCTCCCCTGGGGGAAGG + Intergenic
1135311434 16:21407833-21407855 TGGGCGTTTCCCAAGAGGGTGGG + Intronic
1135364386 16:21840284-21840306 TGGGCGTTTCCCAAGAGGGTGGG + Intronic
1135447457 16:22531064-22531086 TGGGCGTTTCCCAAGAGGGTGGG - Intronic
1136460487 16:30407508-30407530 CGGGCTCCGCCCCAGGGGGTGGG + Exonic
1136690463 16:32024890-32024912 TGGGCTTCCCCCGAGCGGGTGGG + Intergenic
1136791050 16:32968450-32968472 TGGGCTTCCCCCGAGCGGTTGGG + Intergenic
1136878763 16:33885482-33885504 TGGGCTTCCCCCGAGCGGTTGGG - Intergenic
1137464959 16:48699421-48699443 TGAGCATCTCACCAGTGGATGGG + Intergenic
1140455885 16:75105315-75105337 TGGCCTTCTCCCTAGAGGGCCGG + Intronic
1140893356 16:79304166-79304188 TGGATTGCTCCCCAGTGGGCTGG - Intergenic
1141045400 16:80711917-80711939 TGTCCTTCTCCCCTGTCGGTTGG - Intronic
1141746443 16:85929564-85929586 TGGGAGGCTGCCCAGTGGGTGGG + Intergenic
1142395510 16:89829065-89829087 CGGGCTGCTCCCCAGTGGCCTGG + Intronic
1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG + Intergenic
1142709744 17:1716438-1716460 TGGCCGGCTCCTCAGTGGGTGGG - Intergenic
1144147657 17:12413934-12413956 TGGGCTTCTCCCCAAAGGAAAGG - Intergenic
1144164574 17:12596895-12596917 TGGCCTTGTACCCAGTGAGTGGG + Intergenic
1146946542 17:36877498-36877520 AGGGCCCCTCCCCAGTGGGTGGG - Intergenic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1147327516 17:39676567-39676589 TGGGATGCTCCCCAGGGGGGAGG - Intronic
1147455539 17:40535975-40535997 TCGGCTTCTAGCTAGTGGGTGGG + Intergenic
1147864008 17:43541187-43541209 TGGCCTTCTCCCAAAGGGGTAGG + Intronic
1148800292 17:50220953-50220975 TCGGGTCCTCCCCAGTGGGAGGG - Intergenic
1149777102 17:59366606-59366628 CAGGCCTCTCCCCACTGGGTGGG + Intronic
1152174692 17:78780140-78780162 TCGGCTTCTCAGCAGTGGGCAGG + Intronic
1154117305 18:11622453-11622475 TGGGCGTTTCCCAAGAGGGTGGG + Intergenic
1157513484 18:48295106-48295128 TGGGCTTCTCCCCTGTGGAGGGG - Intronic
1158391884 18:57051127-57051149 TGGGCTTCTCCCCAAGGCCTGGG - Intergenic
1159178802 18:64874518-64874540 TGGGTTTGTCTCCAGTGTGTGGG - Intergenic
1161990335 19:7681028-7681050 TGGGTTTCTCCCCAGTGTAGAGG + Intronic
1162457780 19:10796331-10796353 TTGGCCTCTCCCCAGAGGCTGGG + Intronic
1163153294 19:15427313-15427335 TGGGCTTGGCCCTGGTGGGTTGG + Exonic
1164193800 19:22935610-22935632 TGGGCTTTTCCCCAGCAGGAGGG - Intergenic
1165056018 19:33176751-33176773 GGGGGTTCTCCGGAGTGGGTAGG + Intergenic
1165187426 19:34034054-34034076 TGAGTTTCTTCCCAGTGGGGTGG - Intergenic
1167583902 19:50362201-50362223 TGGGCTTGTCCCCAGGGGATGGG + Exonic
1167997087 19:53414500-53414522 TGGGCTTTTCCCCGGGGGGGGGG - Intronic
925283285 2:2699855-2699877 TGGGAGTCTCCCCTGTGGCTTGG - Intergenic
927516062 2:23672265-23672287 TGGGATTGTCCCCAGTAGGAAGG + Intronic
927552484 2:24011450-24011472 TGTGGTTTTCCCCTGTGGGTAGG + Intronic
929983708 2:46704926-46704948 TTCTCTTCTCCCCAGTGGTTGGG - Intronic
931633591 2:64322623-64322645 TGGGCATAACCCCAGTCGGTGGG + Intergenic
934819543 2:97360289-97360311 AGGGCTCCTCCCCAGGGGCTGGG - Intergenic
936079335 2:109421649-109421671 TGGGCTTCTCCCCCAGGGGAGGG + Intronic
936545365 2:113387801-113387823 TGGGATTCCCCCCAATAGGTGGG - Intergenic
938879685 2:135572071-135572093 TTGGCTTCTCCCAGGTGGCTGGG + Intronic
946032158 2:216713915-216713937 TGGGCATCCGCCAAGTGGGTGGG - Intergenic
946355400 2:219181447-219181469 CTGGCTTCTCCCCAGTGGTGAGG + Exonic
947702789 2:232249181-232249203 TGGGCTTCTCCTAAGCGGGTTGG + Intronic
948359065 2:237405547-237405569 TGGGCTTCTGTCTTGTGGGTGGG + Intronic
948756593 2:240163034-240163056 AGGGCGTGCCCCCAGTGGGTGGG + Intergenic
948856170 2:240731720-240731742 TGGGGGTCTTCCCAGTGGGGAGG - Intronic
1168991862 20:2102582-2102604 TGAGCTGCTGCCCAGTGGTTCGG + Intronic
1174414403 20:50357573-50357595 TGGGCTCCTCACCGGTGGGGTGG - Intergenic
1175470611 20:59224288-59224310 TGGGCTTCTCATCCGTGGTTTGG + Intronic
1175783035 20:61695836-61695858 TGGGCTTTGCCCCAGTGACTTGG + Intronic
1175977303 20:62717390-62717412 TTGGGTTGTCCCCAGTGGCTTGG + Intronic
1176131047 20:63496985-63497007 TGGGCTTCTCCCCAGAGTCCTGG + Intronic
1182577520 22:31283060-31283082 TGGGCTCCTGCCCACTGGGGGGG + Exonic
1183374209 22:37453627-37453649 TGGTCCTCTCCACATTGGGTAGG - Intergenic
1185245457 22:49770693-49770715 TGGGCGCCCCCACAGTGGGTGGG + Intergenic
1185379939 22:50503688-50503710 TGGGCTTTTCTCCTGTGGGAGGG + Exonic
1185412992 22:50695643-50695665 TGGGCTTCTCATCAGTAAGTGGG + Intergenic
950609417 3:14116371-14116393 TGAGCTTCTCCCCAGTGCCCTGG + Intronic
950675376 3:14551182-14551204 TGACTATCTCCCCAGTGGGTGGG + Intergenic
950693651 3:14681197-14681219 TAGCCTTCTCACCACTGGGTGGG + Intronic
952004490 3:28826867-28826889 TGAACTTCTCCCTGGTGGGTTGG + Intergenic
955688264 3:61565180-61565202 TGAGCTTTTTCCCAGTGGATTGG + Intronic
956250377 3:67229004-67229026 TGATGTGCTCCCCAGTGGGTAGG + Intergenic
961544362 3:127621949-127621971 TGTGCTTCTCACCTTTGGGTGGG + Exonic
961669765 3:128520489-128520511 TGAGCTTCTTCCCAGTGGGCTGG - Intergenic
962754623 3:138458305-138458327 GGGGCTGGTCCCAAGTGGGTTGG + Intronic
968517573 4:1021279-1021301 TCGGCTTCTCCACATAGGGTGGG + Intronic
971268259 4:25113469-25113491 TGGGCTTCTTCCCAAGGTGTGGG + Intergenic
971470675 4:27022697-27022719 TGGGGTTCTCCCGACTGTGTAGG + Exonic
972422680 4:38904405-38904427 TGGGGTTTTTCCCTGTGGGTAGG + Intronic
975689790 4:76951194-76951216 TGAACTTCTCCCGAGGGGGTAGG - Intronic
976505067 4:85836935-85836957 TGGGCTTCTACTCTGTGAGTTGG - Intronic
977941145 4:102860813-102860835 TGGGCTGCTGGCTAGTGGGTGGG + Intronic
984439187 4:179745427-179745449 TGGGCATATACCCAGTTGGTGGG - Intergenic
984896936 4:184549221-184549243 CGGGCTCCTCCCCAGTGCGAAGG + Intergenic
985489828 5:172618-172640 AGGGCTCCTCCCCTGTGTGTGGG + Intronic
985534255 5:454449-454471 TGGTCTCCTCCCCAGTGGGGTGG - Intronic
986047397 5:4052675-4052697 TGGGGTTCTCCTCAGTTGGCGGG - Intergenic
987147551 5:15006926-15006948 TGGTCATCTCCCCAATGGGGAGG - Intergenic
987331748 5:16863286-16863308 TGGGCTTCTCCCCAGTGGGTGGG - Intronic
989957733 5:50375615-50375637 TGGGGGTTTCCCCAGTGGTTAGG - Intergenic
990327508 5:54692726-54692748 TGTGTTTCTCACCAGTTGGTTGG - Intergenic
992889328 5:81189316-81189338 TGGGCATGTCCCCAGCTGGTAGG + Intronic
995768964 5:115649264-115649286 TGAGCTTCTCCACAGTAGTTGGG + Intergenic
996698356 5:126423383-126423405 TCGGCTTTTCCACAGTGGGTCGG + Intronic
997516351 5:134492479-134492501 TGGGCTTCTCAGCAGTGGATGGG + Intergenic
999200497 5:149812888-149812910 TGGGCTTCCACCCACTGGGAGGG + Intronic
999821513 5:155233551-155233573 AGGGCTTCTGCCCAGAGGGCTGG + Intergenic
1006595811 6:35192026-35192048 TCGGTTGCTCCCCAGTGGGGCGG + Intergenic
1006925023 6:37649291-37649313 GGGGCCTCTCCCCAGCGAGTGGG + Intronic
1007189278 6:39999540-39999562 TGTGCCTCTGCCCAGTGAGTGGG - Intergenic
1009308901 6:62125306-62125328 TGGGCATTTCCCCTCTGGGTAGG - Intronic
1012468949 6:99548308-99548330 TGGTGTCCTACCCAGTGGGTAGG - Intronic
1013706040 6:112835263-112835285 TGGGCTTGGCTCCAGTTGGTAGG + Intergenic
1021863818 7:24934512-24934534 TGTGCTACTCCCTAGTGGTTGGG - Intronic
1024646584 7:51376115-51376137 AGGGGTTCTGCCCAGTGGATGGG - Intergenic
1029126462 7:98298136-98298158 GGGGCTTCTCCCAAGGGGGCAGG - Intronic
1030634002 7:111927471-111927493 GGGGCTTCTCCACATTTGGTAGG + Intronic
1031847548 7:126824569-126824591 TGGGCTTAGCCACAGTTGGTAGG - Intronic
1031973801 7:128081566-128081588 GGGGCCTCTGCCCAGTGGGTGGG + Intronic
1034070961 7:148184487-148184509 TGTGCTTCTCCCTAGGGAGTTGG + Intronic
1035527013 8:321820-321842 TGTGCTTGTCCTCAGAGGGTGGG - Intergenic
1036055078 8:5242888-5242910 TGGACTTCTCCCCTGTAGGGAGG + Intergenic
1036204487 8:6794947-6794969 TGTGCTTCACGCCAGTGAGTAGG + Intergenic
1036616176 8:10389605-10389627 GGGCCTGCTCCCCGGTGGGTGGG - Intronic
1038956938 8:32478249-32478271 TGGGCTTCTTCCATGTGGGGGGG + Intronic
1040408480 8:47132776-47132798 TGGGCTTCCCCCCGCCGGGTGGG - Intergenic
1041437883 8:57862181-57862203 CGGGCTTTTCCCCCTTGGGTTGG + Intergenic
1041441114 8:57898069-57898091 TGGGCTTGTCCCCAGAGTTTGGG - Intergenic
1041950033 8:63490323-63490345 TTGGCTCCTCCCCCGTTGGTAGG + Intergenic
1042704523 8:71652121-71652143 AGGGCAGCTCCTCAGTGGGTTGG + Intergenic
1043502626 8:80873243-80873265 GGCGCTTCTCCCCAGTGAGGTGG - Intronic
1044087650 8:87959913-87959935 TGGTTTTCTCCCCTGTGGGATGG - Intergenic
1046603023 8:116339961-116339983 TGGCCTTGTTACCAGTGGGTGGG - Intergenic
1048217171 8:132506890-132506912 GGTGCTCCTCCCCACTGGGTCGG - Intergenic
1049203043 8:141351103-141351125 TGGGCTTTGCCCCTGTAGGTGGG - Intergenic
1049466613 8:142753849-142753871 TGGTCTTCGCCCCAGTGGCTGGG + Intergenic
1051825082 9:21210941-21210963 GCTGCTTCTCCTCAGTGGGTGGG + Intronic
1052283017 9:26754399-26754421 AGGTCTTTTCCACAGTGGGTGGG - Intergenic
1056718774 9:89055680-89055702 TGGGCTTCTCCCAAGCAGGAGGG + Intronic
1057313259 9:93954546-93954568 TGGGCTTCGCCGCAGAGGGATGG - Intronic
1059326671 9:113507910-113507932 TGTGCTTTTCCCCAGTGGAATGG + Intronic
1059334374 9:113559509-113559531 TGGGCTTCTCCTTGCTGGGTTGG + Intronic
1059339743 9:113591073-113591095 CTGGCTTCTCCCCAGTGAGCTGG + Intronic
1061183470 9:129038284-129038306 ACAGCTTCTCCCCAGTGAGTGGG - Intronic
1061918408 9:133769175-133769197 TGGGCGTGTCCACAGGGGGTGGG + Intronic
1062340120 9:136090427-136090449 GGGGCTTCCGCCCAGTGGGCTGG - Intronic
1062403743 9:136383737-136383759 TGGGCCTCTCCCCAAAGGGCTGG - Intronic
1187294001 X:17981274-17981296 TGGACTTCTCCTCATTGGTTTGG + Intergenic
1188957420 X:36449527-36449549 AGGGCTTTTCCCCATTGTGTTGG + Intergenic
1191117479 X:56866792-56866814 TGATATGCTCCCCAGTGGGTAGG - Intergenic
1192738374 X:73870425-73870447 TGGTCTTCTTACCAGTGGTTTGG - Intergenic
1195968651 X:110451676-110451698 TGGGCATCACTCCAGAGGGTAGG - Exonic
1196485686 X:116204043-116204065 TGGGCTATTCCCCACTGGCTAGG + Intergenic
1199918710 X:152373286-152373308 GGGGCCTCTCCACAGTGGGTTGG - Intronic