ID: 987336396

View in Genome Browser
Species Human (GRCh38)
Location 5:16901348-16901370
Sequence GAGAGTAGAACCAGCACGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 83}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987336396_987336404 13 Left 987336396 5:16901348-16901370 CCACCCGTGCTGGTTCTACTCTC 0: 1
1: 0
2: 1
3: 9
4: 83
Right 987336404 5:16901384-16901406 AAGGTGGTGCCCAGCAAAGAAGG 0: 1
1: 0
2: 2
3: 20
4: 253
987336396_987336406 21 Left 987336396 5:16901348-16901370 CCACCCGTGCTGGTTCTACTCTC 0: 1
1: 0
2: 1
3: 9
4: 83
Right 987336406 5:16901392-16901414 GCCCAGCAAAGAAGGCAGGAAGG 0: 1
1: 0
2: 3
3: 71
4: 928
987336396_987336399 -6 Left 987336396 5:16901348-16901370 CCACCCGTGCTGGTTCTACTCTC 0: 1
1: 0
2: 1
3: 9
4: 83
Right 987336399 5:16901365-16901387 ACTCTCCATCCCAGCACACAAGG 0: 1
1: 0
2: 2
3: 30
4: 232
987336396_987336405 17 Left 987336396 5:16901348-16901370 CCACCCGTGCTGGTTCTACTCTC 0: 1
1: 0
2: 1
3: 9
4: 83
Right 987336405 5:16901388-16901410 TGGTGCCCAGCAAAGAAGGCAGG 0: 1
1: 0
2: 5
3: 29
4: 237
987336396_987336400 -3 Left 987336396 5:16901348-16901370 CCACCCGTGCTGGTTCTACTCTC 0: 1
1: 0
2: 1
3: 9
4: 83
Right 987336400 5:16901368-16901390 CTCCATCCCAGCACACAAGGTGG 0: 1
1: 0
2: 4
3: 15
4: 191
987336396_987336409 24 Left 987336396 5:16901348-16901370 CCACCCGTGCTGGTTCTACTCTC 0: 1
1: 0
2: 1
3: 9
4: 83
Right 987336409 5:16901395-16901417 CAGCAAAGAAGGCAGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987336396 Original CRISPR GAGAGTAGAACCAGCACGGG TGG (reversed) Intronic
901447701 1:9318294-9318316 GAGAGAACAACCAGCAAGGGAGG - Intronic
904337044 1:29804691-29804713 GAGATTATAATCAGCAAGGGAGG + Intergenic
904917696 1:33982248-33982270 CAGAGGAGAACCAGGGCGGGAGG + Intronic
905275148 1:36812740-36812762 GAGAGTAGAACTCACAAGGGAGG - Intronic
907644024 1:56223104-56223126 GAGAGTGGAACTAGAACTGGTGG - Intergenic
907646615 1:56250947-56250969 GGGAGTAGAAGCAGAAAGGGAGG - Intergenic
909860019 1:80593489-80593511 GAGAGAAGGAACAACACGGGAGG + Intergenic
915062067 1:153194502-153194524 GAGAGTGGGAGCAGCACGTGTGG - Intergenic
920717354 1:208352879-208352901 GAGAGTAGAACCCCCACAGATGG - Intergenic
920727957 1:208454848-208454870 GAGAGTAAAATAAGCAGGGGTGG + Intergenic
921839294 1:219811394-219811416 GAGAATAGAACCAACCAGGGTGG - Intronic
923299161 1:232625099-232625121 GTCAGTAGAACCAGCAAAGGAGG + Intergenic
1067038489 10:42935691-42935713 GCCAGTAGGACCAGCATGGGTGG - Intergenic
1068332715 10:55592317-55592339 GAGAGAAGAACAAGAACTGGAGG + Intronic
1068381933 10:56265455-56265477 GAGAGAAGAGCCAGCAAAGGAGG + Intergenic
1076413685 10:130269931-130269953 GAGAATGGAACCAGCCCGTGAGG + Intergenic
1076677909 10:132157188-132157210 GAGAAGAGAACCAGCAAGTGGGG - Intronic
1081232645 11:40605175-40605197 AAGAGTAGCATCAGCAAGGGAGG + Intronic
1081532471 11:43971819-43971841 GAGAGTAGAGGCAGCACGATTGG - Intergenic
1084659846 11:70540299-70540321 GAGAACAGAACCAGCAAGCGGGG + Intronic
1088384380 11:109236997-109237019 GAGACTGGAACCAGGAAGGGTGG - Intergenic
1090789429 11:130077883-130077905 GTGGGTAGAAGCAGCAAGGGTGG - Intronic
1093975287 12:25414557-25414579 GAGAATAAAACCAACACAGGGGG + Intronic
1095708660 12:45265249-45265271 TACAGTAGATCCAACACGGGAGG - Intronic
1103530171 12:121595618-121595640 GGGAGTAGAGCCAGGACTGGTGG + Intergenic
1103993645 12:124815316-124815338 GAGAGCAGAACGAGGCCGGGTGG - Intronic
1104823090 12:131689497-131689519 GAGAGAAGAGACAGCACGAGGGG - Intergenic
1105038117 12:132941246-132941268 GAGAGCAGAAGCAGCACACGCGG - Intronic
1106172290 13:27298312-27298334 AAGGGTAGAACCAGGATGGGTGG + Intergenic
1107276568 13:38686818-38686840 GAGAGTAGCGCAAGCAGGGGTGG + Intergenic
1109357777 13:61253656-61253678 GAGCAGAGAACCAACACGGGTGG + Intergenic
1113351460 13:109533510-109533532 GTGAGCAGAACCATCAGGGGCGG + Intergenic
1130033943 15:80341203-80341225 GAGAGCATAGCCAGAACGGGTGG - Intergenic
1131502405 15:92981730-92981752 GAGTGTAGAACCAGGACGTGTGG + Intronic
1133254884 16:4510474-4510496 GAGAGTAGACCCAGAGCAGGAGG - Intergenic
1137377565 16:47966185-47966207 GAGAATGGAACAAGCAAGGGTGG + Intergenic
1141256348 16:82405782-82405804 GAGAGTAGAACTAGCTCAGAAGG + Intergenic
1143906865 17:10216187-10216209 GGGAGTAGGACCAGCACAGGAGG + Intergenic
1147262602 17:39217392-39217414 GAGAGGAGCACCACCAAGGGTGG - Intronic
1152532688 17:80929280-80929302 TAGACTGGAACAAGCACGGGAGG + Intronic
1152602941 17:81274235-81274257 GAGAGGAGCACCAGCACGTGGGG + Intronic
1156872885 18:41967911-41967933 GAGAGAAGAAACAGCACAGCAGG - Intronic
1156999719 18:43510107-43510129 GGGAGTAGAAGCTGCAGGGGTGG - Intergenic
1163848862 19:19652400-19652422 GAGAGAGGAGCCAGCACAGGCGG + Intronic
1164554998 19:29244576-29244598 GAGAATACAGCCAGCACTGGAGG - Intergenic
1166340557 19:42134438-42134460 GAGAATGGAGCCAGCATGGGAGG - Intronic
1167291660 19:48628256-48628278 GAGCAGTGAACCAGCACGGGGGG + Exonic
928220078 2:29396173-29396195 TGGAGTATAAGCAGCACGGGAGG - Intronic
928764140 2:34621720-34621742 GAGAGTAGAACCCTCACGGATGG + Intergenic
930417945 2:51113560-51113582 AATAGTAAAACCAGCATGGGAGG - Intergenic
935382297 2:102465084-102465106 GATAATTGAACCAGCATGGGTGG - Intergenic
947039006 2:225893411-225893433 GAGGGTAGAACCAGGAAGGATGG + Intergenic
947745703 2:232506342-232506364 GAGAGAAGAAGCAGAAAGGGAGG + Intergenic
948316941 2:237035186-237035208 CAGAGGAGAAGCAGCACAGGTGG + Intergenic
1168957373 20:1843763-1843785 GAGAGTAGAGAGAGCAAGGGAGG + Intergenic
1176034076 20:63028010-63028032 GAGTGAAGAACCAACGCGGGCGG + Intergenic
1178824888 21:36006517-36006539 GACAGGAGAATCAGCATGGGGGG + Intergenic
1180976645 22:19852282-19852304 GAGAGGAGAGCCAGCACTGGTGG + Exonic
1182010264 22:26994934-26994956 CAGAGTAGAACCAGCACGTGCGG + Intergenic
1182904209 22:33921698-33921720 GAGAATAAAATCAGCAGGGGAGG - Intronic
949437250 3:4042920-4042942 GAGAGAATAAGCAGCACTGGTGG - Intronic
953575568 3:44110727-44110749 GAGAGCAGGATCAGCACGGAGGG + Intergenic
955596571 3:60596888-60596910 TACAGTAGAAACAGCACAGGGGG - Intronic
960990794 3:123309896-123309918 GAAAGGAGAACCAGCAAGGTGGG + Intronic
968604803 4:1529825-1529847 CAGAGTAAAACCAGCACTGAGGG + Intergenic
968758395 4:2428360-2428382 GAGAGACGTAGCAGCACGGGTGG - Intronic
969317282 4:6389903-6389925 GAGAGGAGAACCAGGCCTGGGGG - Intronic
969343626 4:6557893-6557915 GAGAGTAGAACCAGGGCCTGTGG - Intronic
971294675 4:25377577-25377599 GGGAGCAGACCCAGCACAGGCGG - Intronic
973200076 4:47490662-47490684 AGGAGTGGAGCCAGCACGGGTGG + Intronic
979029148 4:115618375-115618397 CTGAGTAGAAGCAGCACGGATGG - Intergenic
981853880 4:149263768-149263790 GAAAGTGGCACCAGCATGGGTGG - Intergenic
985028720 4:185767101-185767123 GAGAGAAAAACAAGCACGGGAGG - Intronic
987336396 5:16901348-16901370 GAGAGTAGAACCAGCACGGGTGG - Intronic
997509820 5:134446490-134446512 GAGAGTAGGACCAGCCAGGCAGG - Intergenic
999104774 5:149061763-149061785 GAGAGTAGAAACAGCATGGAGGG - Intronic
1002879510 6:1238588-1238610 GAGACTAGAACAATCACGGTGGG - Intergenic
1016454104 6:144213814-144213836 GAGAATAAAGCCGGCACGGGGGG - Intergenic
1023775507 7:43602224-43602246 GGGAAAAGAACCACCACGGGAGG - Intronic
1026611136 7:71860841-71860863 GAGAGTAGCACCACCCAGGGAGG - Intronic
1028773199 7:94650793-94650815 GAAAGTAGAACTAGCATCGGTGG - Intronic
1030410567 7:109173693-109173715 GATAATATAACAAGCACGGGTGG - Intergenic
1031350725 7:120727833-120727855 GAGAGTAGAAAGAGTATGGGGGG + Intronic
1031981628 7:128130734-128130756 CAGAGTAGACACAGCAGGGGAGG + Intergenic
1036458106 8:8927219-8927241 GAGAATAGCACCAACCCGGGAGG + Intergenic
1038128522 8:24701891-24701913 GAGAGTAGCACCATCACTTGGGG + Intergenic
1044475319 8:92618919-92618941 GAGAGTCCAACCTCCACGGGGGG + Intergenic
1049261725 8:141642548-141642570 GAGAGGAGAAACAGCATCGGAGG + Intergenic
1056713073 9:89007333-89007355 TAAAGTAGAACCAGCAAGGGTGG - Intergenic
1058972044 9:110092766-110092788 GAGAATAGAACCAACACAGAGGG - Intronic
1186441994 X:9594493-9594515 GAGTGTAAAACCAAGACGGGAGG - Intronic
1187394158 X:18905679-18905701 GACATTAGAACCAGCACTGTGGG - Intronic
1188971526 X:36622732-36622754 GAGAGTAGAACCTTCATGGATGG + Intergenic
1195935888 X:110125483-110125505 GAGAGGAGAACTGGCTCGGGTGG + Intronic