ID: 987340314

View in Genome Browser
Species Human (GRCh38)
Location 5:16934247-16934269
Sequence GGGTCCGTGGCTCCCCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987340314_987340324 5 Left 987340314 5:16934247-16934269 CCCCAAGGGGGAGCCACGGACCC 0: 1
1: 0
2: 0
3: 5
4: 153
Right 987340324 5:16934275-16934297 GTGCTCAGACAGGCTACAGGAGG No data
987340314_987340319 -5 Left 987340314 5:16934247-16934269 CCCCAAGGGGGAGCCACGGACCC 0: 1
1: 0
2: 0
3: 5
4: 153
Right 987340319 5:16934265-16934287 GACCCCTGTGGTGCTCAGACAGG No data
987340314_987340323 2 Left 987340314 5:16934247-16934269 CCCCAAGGGGGAGCCACGGACCC 0: 1
1: 0
2: 0
3: 5
4: 153
Right 987340323 5:16934272-16934294 GTGGTGCTCAGACAGGCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987340314 Original CRISPR GGGTCCGTGGCTCCCCCTTG GGG (reversed) Intronic