ID: 987340318 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:16934260-16934282 |
| Sequence | CTGAGCACCACAGGGGTCCG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 213 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 13, 4: 197} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 987340318_987340324 | -8 | Left | 987340318 | 5:16934260-16934282 | CCACGGACCCCTGTGGTGCTCAG | 0: 1 1: 0 2: 2 3: 13 4: 197 |
||
| Right | 987340324 | 5:16934275-16934297 | GTGCTCAGACAGGCTACAGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 987340318 | Original CRISPR | CTGAGCACCACAGGGGTCCG TGG (reversed) | Intronic | ||