ID: 987340319

View in Genome Browser
Species Human (GRCh38)
Location 5:16934265-16934287
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987340315_987340319 -6 Left 987340315 5:16934248-16934270 CCCAAGGGGGAGCCACGGACCCC 0: 1
1: 0
2: 0
3: 5
4: 116
Right 987340319 5:16934265-16934287 GACCCCTGTGGTGCTCAGACAGG No data
987340307_987340319 22 Left 987340307 5:16934220-16934242 CCCACTTGCACTAGGGGGCAGAG 0: 1
1: 1
2: 0
3: 10
4: 85
Right 987340319 5:16934265-16934287 GACCCCTGTGGTGCTCAGACAGG No data
987340305_987340319 24 Left 987340305 5:16934218-16934240 CCCCCACTTGCACTAGGGGGCAG 0: 1
1: 0
2: 0
3: 6
4: 78
Right 987340319 5:16934265-16934287 GACCCCTGTGGTGCTCAGACAGG No data
987340308_987340319 21 Left 987340308 5:16934221-16934243 CCACTTGCACTAGGGGGCAGAGT 0: 1
1: 0
2: 0
3: 4
4: 99
Right 987340319 5:16934265-16934287 GACCCCTGTGGTGCTCAGACAGG No data
987340304_987340319 25 Left 987340304 5:16934217-16934239 CCCCCCACTTGCACTAGGGGGCA 0: 1
1: 0
2: 0
3: 9
4: 99
Right 987340319 5:16934265-16934287 GACCCCTGTGGTGCTCAGACAGG No data
987340314_987340319 -5 Left 987340314 5:16934247-16934269 CCCCAAGGGGGAGCCACGGACCC 0: 1
1: 0
2: 0
3: 5
4: 153
Right 987340319 5:16934265-16934287 GACCCCTGTGGTGCTCAGACAGG No data
987340306_987340319 23 Left 987340306 5:16934219-16934241 CCCCACTTGCACTAGGGGGCAGA 0: 1
1: 0
2: 0
3: 4
4: 104
Right 987340319 5:16934265-16934287 GACCCCTGTGGTGCTCAGACAGG No data
987340316_987340319 -7 Left 987340316 5:16934249-16934271 CCAAGGGGGAGCCACGGACCCCT 0: 1
1: 0
2: 0
3: 4
4: 132
Right 987340319 5:16934265-16934287 GACCCCTGTGGTGCTCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type