ID: 987340540

View in Genome Browser
Species Human (GRCh38)
Location 5:16935865-16935887
Sequence TGGTTTCCCCGGACCCGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987340540_987340550 19 Left 987340540 5:16935865-16935887 CCGCCGCGGGTCCGGGGAAACCA 0: 1
1: 0
2: 0
3: 3
4: 48
Right 987340550 5:16935907-16935929 CCCGAGGACGCGCGCCCGCGGGG 0: 1
1: 0
2: 0
3: 16
4: 100
987340540_987340548 18 Left 987340540 5:16935865-16935887 CCGCCGCGGGTCCGGGGAAACCA 0: 1
1: 0
2: 0
3: 3
4: 48
Right 987340548 5:16935906-16935928 TCCCGAGGACGCGCGCCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 67
987340540_987340547 17 Left 987340540 5:16935865-16935887 CCGCCGCGGGTCCGGGGAAACCA 0: 1
1: 0
2: 0
3: 3
4: 48
Right 987340547 5:16935905-16935927 CTCCCGAGGACGCGCGCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 71
987340540_987340545 3 Left 987340540 5:16935865-16935887 CCGCCGCGGGTCCGGGGAAACCA 0: 1
1: 0
2: 0
3: 3
4: 48
Right 987340545 5:16935891-16935913 GTGTCACGGCGCCACTCCCGAGG 0: 1
1: 0
2: 0
3: 3
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987340540 Original CRISPR TGGTTTCCCCGGACCCGCGG CGG (reversed) Exonic
900237732 1:1600543-1600565 TGGCCGCCCTGGACCCGCGGCGG + Intergenic
901450513 1:9333836-9333858 TGTTTTCCCCGGAGCCGCGCTGG - Intronic
922130482 1:222772286-222772308 TGGTTTCCCTGGCCCCTAGGTGG + Intergenic
922475557 1:225905006-225905028 TGGTTTCCCTAGACCCAGGGTGG + Intronic
1066004558 10:31134344-31134366 CGGTCCCCCGGGACCCGCGGTGG + Intergenic
1074130416 10:110568251-110568273 TGGCTTCCCCGGCCCGGGGGCGG + Intronic
1075806893 10:125195612-125195634 TGGTTTCCCAGGACCAGCCTTGG - Intergenic
1083227501 11:61294354-61294376 TGCTTTCCCCCGGGCCGCGGTGG - Intronic
1084574240 11:69978228-69978250 TGTTTTCGTCGGACCCGAGGTGG - Intergenic
1094166710 12:27450538-27450560 TGGCTTCCCAGGAGCCGCTGAGG - Intergenic
1095308707 12:40669210-40669232 TGGTTTGCCAGGACTCGGGGAGG + Intergenic
1113926798 13:113946340-113946362 GGGTTTCCCAGGACCCTCGGGGG + Intergenic
1113955428 13:114097931-114097953 TGGTCTCCCTGGACCCCCTGTGG - Intronic
1125626880 15:41116134-41116156 TGGGGTCCCAGGAGCCGCGGAGG - Exonic
1136139802 16:28281408-28281430 TGGTGTCCCGGGACTCGGGGAGG - Intergenic
1137735369 16:50719627-50719649 TGGTTTCCCCGGGACAGCGAGGG - Intronic
1144787498 17:17840188-17840210 TGGCTGCGCCGGGCCCGCGGGGG - Intergenic
1147585363 17:41651368-41651390 GGGTTTCCCTGGACCAGTGGTGG - Intergenic
1148786558 17:50148844-50148866 AGGTGTCCCAGGACCCGCGTGGG + Intronic
1152659170 17:81534541-81534563 TGGTCTCCCAGGACCCCTGGGGG - Intronic
1152756753 17:82090247-82090269 GGGTGTCCCCGGGCCAGCGGGGG + Intronic
1153534772 18:6089132-6089154 TGGTTTCCCCAGGCCTGAGGGGG - Intronic
1156458009 18:37305572-37305594 TGGTTTTCCCAGACCCACAGTGG + Intronic
1160832234 19:1109410-1109432 TTGTTACCGCGGACCTGCGGAGG + Exonic
1163405607 19:17120215-17120237 TGGCTTCCCCAGACCCAAGGAGG + Intronic
1164853458 19:31502932-31502954 TGAATGCCCCGGACCCGCAGAGG - Intergenic
1164853477 19:31503029-31503051 TGGGTGCCCCGGACCTGCAGAGG - Intergenic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
932038707 2:68275662-68275684 TGGTTCCCCCTTACCCGTGGGGG - Intergenic
937488660 2:122342270-122342292 TGGTTTCACCGGTCCCCCAGTGG + Intergenic
948352568 2:237353098-237353120 TGGTTTCCAGGGACTCGGGGTGG + Intronic
948549486 2:238760234-238760256 TGGTTCCCCAGGACCCTCTGAGG - Intergenic
1177709765 21:24758957-24758979 TGGTTTCCCCCCACCCGCCGAGG + Intergenic
1178708327 21:34891349-34891371 GGGTTTCCCCGGAGCGGCGCAGG + Intronic
1179908717 21:44437021-44437043 TGGCTGCCCAGGACCCGCTGCGG - Intronic
1181631982 22:24156272-24156294 TGGTTTCCCCGGCGCCCCCGCGG + Intronic
1184059709 22:42074421-42074443 TGGTTTCCCCGTCCTCGCGTCGG - Intronic
954663377 3:52237771-52237793 AGGTTTCCCTGGCCCCGCGAAGG - Intronic
962247218 3:133805850-133805872 TGGCTTCCGCGGACTCGCGCCGG + Exonic
971195945 4:24471839-24471861 AGGCGTCCCCTGACCCGCGGAGG - Intergenic
979675265 4:123402523-123402545 TGGTTTACCCTGACCCCGGGAGG - Exonic
980481593 4:133395106-133395128 TGGTTGCCCCCAACCAGCGGAGG - Intergenic
987340540 5:16935865-16935887 TGGTTTCCCCGGACCCGCGGCGG - Exonic
995917235 5:117262650-117262672 TGCTTTCCCCAGACTCGGGGGGG - Intergenic
998399742 5:141842495-141842517 TGGTGTCCCCGTATCCACGGAGG - Intergenic
1001880942 5:175243579-175243601 TGGTTGCCACTGACCCACGGAGG - Intergenic
1002344080 5:178535948-178535970 TGGATTCCCAGGACCCGAGAGGG + Intronic
1003871170 6:10404458-10404480 TGGTTCCCCCGGCCGCGGGGCGG + Intronic
1018001839 6:159586510-159586532 TGGTTTCCAGGGACCTGGGGAGG + Intergenic
1026302283 7:69108483-69108505 TGGTTTCCCCGGGCATGCAGAGG + Intergenic
1049785367 8:144448247-144448269 TGGTTGCCCCGGGACTGCGGAGG + Intergenic
1186496721 X:10016452-10016474 AGGTGTCCCCAGCCCCGCGGTGG + Intronic