ID: 987340915

View in Genome Browser
Species Human (GRCh38)
Location 5:16937847-16937869
Sequence ATCTGAACACCAGTGGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987340915_987340918 7 Left 987340915 5:16937847-16937869 CCTGCAACCACTGGTGTTCAGAT No data
Right 987340918 5:16937877-16937899 CAGAACAATTACAGTCATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987340915 Original CRISPR ATCTGAACACCAGTGGTTGC AGG (reversed) Intergenic
No off target data available for this crispr