ID: 987342134

View in Genome Browser
Species Human (GRCh38)
Location 5:16948622-16948644
Sequence GTGTAGAGCTCCAGAGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987342129_987342134 30 Left 987342129 5:16948569-16948591 CCTTCAGGAAGAAAAGGAAGGGT No data
Right 987342134 5:16948622-16948644 GTGTAGAGCTCCAGAGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987342134 Original CRISPR GTGTAGAGCTCCAGAGAGGT AGG Intergenic
No off target data available for this crispr