ID: 987347109

View in Genome Browser
Species Human (GRCh38)
Location 5:16988812-16988834
Sequence CTCTATGTACAGAGAAGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987347104_987347109 17 Left 987347104 5:16988772-16988794 CCAGCCAGAGTGGTTTTCCTGGG No data
Right 987347109 5:16988812-16988834 CTCTATGTACAGAGAAGGCATGG No data
987347107_987347109 0 Left 987347107 5:16988789-16988811 CCTGGGAAGCTTTCTGAGTTGTT No data
Right 987347109 5:16988812-16988834 CTCTATGTACAGAGAAGGCATGG No data
987347106_987347109 13 Left 987347106 5:16988776-16988798 CCAGAGTGGTTTTCCTGGGAAGC No data
Right 987347109 5:16988812-16988834 CTCTATGTACAGAGAAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987347109 Original CRISPR CTCTATGTACAGAGAAGGCA TGG Intergenic
No off target data available for this crispr