ID: 987351866

View in Genome Browser
Species Human (GRCh38)
Location 5:17029537-17029559
Sequence CTTTTTAATGGGATTGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987351866_987351877 1 Left 987351866 5:17029537-17029559 CCCCCAACAATCCCATTAAAAAG No data
Right 987351877 5:17029561-17029583 GGGCAAATGGCCGGGTGCGCTGG No data
987351866_987351879 28 Left 987351866 5:17029537-17029559 CCCCCAACAATCCCATTAAAAAG No data
Right 987351879 5:17029588-17029610 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
987351866_987351876 -7 Left 987351866 5:17029537-17029559 CCCCCAACAATCCCATTAAAAAG No data
Right 987351876 5:17029553-17029575 TAAAAAGTGGGCAAATGGCCGGG 0: 7
1: 22
2: 76
3: 253
4: 855
987351866_987351875 -8 Left 987351866 5:17029537-17029559 CCCCCAACAATCCCATTAAAAAG No data
Right 987351875 5:17029552-17029574 TTAAAAAGTGGGCAAATGGCCGG No data
987351866_987351880 29 Left 987351866 5:17029537-17029559 CCCCCAACAATCCCATTAAAAAG No data
Right 987351880 5:17029589-17029611 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987351866 Original CRISPR CTTTTTAATGGGATTGTTGG GGG (reversed) Intergenic
No off target data available for this crispr