ID: 987351868

View in Genome Browser
Species Human (GRCh38)
Location 5:17029539-17029561
Sequence CACTTTTTAATGGGATTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2248
Summary {0: 15, 1: 168, 2: 469, 3: 582, 4: 1014}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987351868_987351877 -1 Left 987351868 5:17029539-17029561 CCCAACAATCCCATTAAAAAGTG 0: 15
1: 168
2: 469
3: 582
4: 1014
Right 987351877 5:17029561-17029583 GGGCAAATGGCCGGGTGCGCTGG No data
987351868_987351879 26 Left 987351868 5:17029539-17029561 CCCAACAATCCCATTAAAAAGTG 0: 15
1: 168
2: 469
3: 582
4: 1014
Right 987351879 5:17029588-17029610 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
987351868_987351875 -10 Left 987351868 5:17029539-17029561 CCCAACAATCCCATTAAAAAGTG 0: 15
1: 168
2: 469
3: 582
4: 1014
Right 987351875 5:17029552-17029574 TTAAAAAGTGGGCAAATGGCCGG No data
987351868_987351880 27 Left 987351868 5:17029539-17029561 CCCAACAATCCCATTAAAAAGTG 0: 15
1: 168
2: 469
3: 582
4: 1014
Right 987351880 5:17029589-17029611 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
987351868_987351882 30 Left 987351868 5:17029539-17029561 CCCAACAATCCCATTAAAAAGTG 0: 15
1: 168
2: 469
3: 582
4: 1014
Right 987351882 5:17029592-17029614 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
987351868_987351876 -9 Left 987351868 5:17029539-17029561 CCCAACAATCCCATTAAAAAGTG 0: 15
1: 168
2: 469
3: 582
4: 1014
Right 987351876 5:17029553-17029575 TAAAAAGTGGGCAAATGGCCGGG 0: 7
1: 22
2: 76
3: 253
4: 855

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987351868 Original CRISPR CACTTTTTAATGGGATTGTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr