ID: 987351869

View in Genome Browser
Species Human (GRCh38)
Location 5:17029540-17029562
Sequence CCACTTTTTAATGGGATTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 651
Summary {0: 2, 1: 31, 2: 102, 3: 146, 4: 370}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987351869_987351879 25 Left 987351869 5:17029540-17029562 CCAACAATCCCATTAAAAAGTGG 0: 2
1: 31
2: 102
3: 146
4: 370
Right 987351879 5:17029588-17029610 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
987351869_987351880 26 Left 987351869 5:17029540-17029562 CCAACAATCCCATTAAAAAGTGG 0: 2
1: 31
2: 102
3: 146
4: 370
Right 987351880 5:17029589-17029611 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
987351869_987351876 -10 Left 987351869 5:17029540-17029562 CCAACAATCCCATTAAAAAGTGG 0: 2
1: 31
2: 102
3: 146
4: 370
Right 987351876 5:17029553-17029575 TAAAAAGTGGGCAAATGGCCGGG 0: 7
1: 22
2: 76
3: 253
4: 855
987351869_987351882 29 Left 987351869 5:17029540-17029562 CCAACAATCCCATTAAAAAGTGG 0: 2
1: 31
2: 102
3: 146
4: 370
Right 987351882 5:17029592-17029614 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
987351869_987351877 -2 Left 987351869 5:17029540-17029562 CCAACAATCCCATTAAAAAGTGG 0: 2
1: 31
2: 102
3: 146
4: 370
Right 987351877 5:17029561-17029583 GGGCAAATGGCCGGGTGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987351869 Original CRISPR CCACTTTTTAATGGGATTGT TGG (reversed) Intergenic
900807348 1:4776205-4776227 CCACTTGTAAATGAGATTGCTGG - Intronic
902976430 1:20092036-20092058 CCAATTTTGAATGGGTATGTGGG + Intergenic
903087371 1:20874200-20874222 ACACCTAGTAATGGGATTGTTGG + Intronic
903843211 1:26259495-26259517 CCACTTCTTAAAGAGATTCTTGG + Intronic
904383501 1:30126894-30126916 CCTCTTCTTTATGGGTTTGTGGG - Intergenic
904690247 1:32288465-32288487 TCACTTTTTAATGGAAATGTGGG - Intergenic
905247296 1:36623982-36624004 CCACGTTTTTAGGGGATTGGGGG + Intergenic
905965891 1:42094982-42095004 CCACTTTTTGATGGGGCTGTTGG + Intergenic
906392945 1:45434654-45434676 CCATTTTTAAATGGGATTTTCGG + Intronic
906494369 1:46293499-46293521 CAACGTTTTTCTGGGATTGTAGG + Intronic
908913260 1:69097355-69097377 CCACTTTTTGATGGGGTTGTTGG + Intergenic
909311164 1:74151298-74151320 CTACTTTTTAAAGGCACTGTGGG + Intronic
909373652 1:74915554-74915576 CCACTTTTTAATGGGGTTGTTGG + Intergenic
909432345 1:75603843-75603865 CCTATTTTTAATGGGGTTATTGG + Intronic
909473029 1:76050754-76050776 CCACATTTTGATGGGGTTGTTGG + Intergenic
910056404 1:83037955-83037977 CCATTTTTTGATGGGGTTGTTGG - Intergenic
910208895 1:84774507-84774529 GCATGTTTTAATGGGAATGTAGG - Intergenic
910411953 1:86955560-86955582 GCAATTTTTAATGGGAGTGAAGG + Intronic
911117607 1:94262563-94262585 CCACTTTTTAAGTGGGTTGTTGG - Intronic
911614101 1:99989601-99989623 CTATTTTTAAATTGGATTGTCGG + Intronic
911801284 1:102141727-102141749 CCACTTTTTTATGGGGTTGTTGG - Intergenic
912019795 1:105093563-105093585 CCACTTTTTAATGGGGTTGTTGG - Intergenic
912283547 1:108343766-108343788 CCAGTTTTTAATGGGGTTGTTGG - Intergenic
912821705 1:112872887-112872909 TCTCTGTTTAATGAGATTGTAGG - Intergenic
913054670 1:115147051-115147073 TCACTTTTTAACGGGATTATTGG - Intergenic
913132376 1:115852765-115852787 CCGCTTTTTAATGGGATTACTGG + Intergenic
913393404 1:118339785-118339807 AAATTTTTTAATGGGATTGAAGG - Intergenic
913471080 1:119187271-119187293 CTACTTTTTAATGGGATTTTTGG + Intergenic
914966788 1:152266558-152266580 CCACTTGTTGATGGGGTTGTTGG - Intergenic
915846693 1:159273857-159273879 CCACTTTTTGATGGGGTTGTTGG - Intergenic
916229004 1:162520534-162520556 GCACTTTTAAATGGGTTAGTAGG + Intronic
916324221 1:163539139-163539161 CCACTTTGTAAGGATATTGTGGG + Intergenic
916364547 1:164010042-164010064 ACACTTTTTAATTAGATTCTGGG - Intergenic
916386576 1:164279744-164279766 CCTCTTTTTATTGGGGTTGTTGG - Intergenic
917697365 1:177539717-177539739 CCACTTTTTAGTGAGGTTGTTGG - Intergenic
918116033 1:181498486-181498508 CCATTTTTGAATGCTATTGTGGG + Intronic
918159147 1:181881073-181881095 CCACTTTTCAATAGGTTTCTGGG - Intergenic
918827282 1:189340431-189340453 CCACCTTTTAATGGGGTTGTTGG - Intergenic
918996101 1:191762311-191762333 CCAGTTTTTAAAAGAATTGTTGG - Intergenic
919207934 1:194441148-194441170 CCACTTTCGAATGGGATTGTTGG - Intergenic
919245548 1:194978406-194978428 GCACTTTTTAATATGCTTGTTGG + Intergenic
919585227 1:199430204-199430226 CCATTTTTAAATTGGATTATTGG - Intergenic
920567847 1:206989821-206989843 GGACTTTTTAATGGGATTTGAGG + Intergenic
921280763 1:213565009-213565031 ACACTTTTTAATGGACTTATTGG - Intergenic
921768589 1:219005655-219005677 CCATTTTTAAATCAGATTGTTGG + Intergenic
921830267 1:219720736-219720758 CTACTTTTTAATGAGATTATTGG - Intronic
922524562 1:226290196-226290218 CCATTTTTCTATTGGATTGTGGG - Intronic
923002046 1:230014750-230014772 CAACTTTTTAAGGAGCTTGTTGG - Intergenic
923162827 1:231331570-231331592 CCTCTAGTGAATGGGATTGTTGG + Intergenic
924078407 1:240365956-240365978 CCACATCTTTATGGGATTTTTGG - Intronic
924825833 1:247537760-247537782 GCATTTTTTAATGTGCTTGTTGG + Intronic
1063818297 10:9803344-9803366 ACACTTCTTAATGAGAATGTAGG + Intergenic
1064157993 10:12919629-12919651 ACACTCTTTAAAGGGATTATCGG + Intronic
1064260071 10:13778291-13778313 CCACTTTATAATGAGAAAGTGGG + Intronic
1065727693 10:28681882-28681904 CTTCTTTTTAATGGAATTCTTGG + Intronic
1066346202 10:34589255-34589277 ACACTTTTTTAAGTGATTGTGGG - Intronic
1067556032 10:47272680-47272702 CCATTTTTAAATGAGATTCTTGG + Intergenic
1067664750 10:48267632-48267654 CCATTTTGAAATTGGATTGTTGG - Intronic
1068702875 10:60038438-60038460 CCACTTGTTAATGGGGTGGGTGG + Intronic
1069308914 10:67008602-67008624 CCAGTTTTGAAGGGGATTGATGG + Intronic
1070375157 10:75823270-75823292 CCACTTTTTAATGGGTTATTTGG - Intronic
1070413584 10:76168013-76168035 GCAATTGTGAATGGGATTGTAGG + Intronic
1070478456 10:76853945-76853967 CCCATTTTTAATGGGATTATTGG - Intergenic
1070787168 10:79168605-79168627 CCAGTTGTTAATGTGCTTGTGGG + Intronic
1071200713 10:83218805-83218827 CCACTTCTTTGGGGGATTGTGGG - Intergenic
1071357697 10:84814367-84814389 CCACTTTCTAATCGAGTTGTTGG + Intergenic
1071405393 10:85325095-85325117 GCATTTTTTAATAGGTTTGTTGG + Intergenic
1071507738 10:86242850-86242872 CCACTTGTTACTGTGACTGTGGG - Intronic
1071749066 10:88454305-88454327 CCATATTTTGATGGCATTGTGGG + Intronic
1071899589 10:90106019-90106041 CCATTTTTTAATCAGATTATTGG - Intergenic
1071913012 10:90257193-90257215 ATACTTAGTAATGGGATTGTTGG - Intergenic
1073826238 10:107325637-107325659 CCACATTTTAATGTGCTTATTGG + Intergenic
1074204840 10:111273871-111273893 CCTCTTTTTATTGGGAGTTTTGG - Intergenic
1074238396 10:111609916-111609938 CCACTTTTTGATGGGGCTGTTGG - Intergenic
1074241334 10:111642391-111642413 CCACTTTTTGATGGGGCTGTTGG - Intergenic
1075816512 10:125268749-125268771 CCACTTTTTAATAGGGTCATTGG + Intergenic
1076436852 10:130452383-130452405 CAAATGTTTTATGGGATTGTTGG + Intergenic
1078094973 11:8291230-8291252 CCTCTTTTTAATGAAAGTGTGGG + Intergenic
1078242329 11:9541164-9541186 CCACTTTTTGATGGGGTTGTTGG + Intergenic
1078433042 11:11302311-11302333 CCCCATTTTACTGGGATTGCTGG + Intronic
1078688530 11:13555787-13555809 CCACTTTTTGATGCGGTTGTTGG + Intergenic
1079271874 11:18994837-18994859 CCCATTTTTAATCGGATTATTGG + Intergenic
1079276722 11:19045278-19045300 CTACTTTTTAATGGGGTTGTTGG - Intergenic
1079278767 11:19068947-19068969 TCATTTTTAAATTGGATTGTTGG + Intergenic
1079550669 11:21693376-21693398 CCATTTTTTGATGGGGTTGTTGG + Intergenic
1079627160 11:22629636-22629658 TCACTTCTTAATGGGATTATTGG + Intronic
1079666423 11:23112136-23112158 ACACTTTTTAAGGTGTTTGTTGG - Intergenic
1079821930 11:25142242-25142264 CCACTTTTTGATGGGGTTGTTGG + Intergenic
1079868354 11:25763603-25763625 CTACTTTTGGATGGGGTTGTTGG - Intergenic
1079949802 11:26786478-26786500 CTACCTTTTCATGGAATTGTGGG + Intergenic
1080154117 11:29088220-29088242 GCACATTTAAATGGGATTTTTGG - Intergenic
1080716213 11:34803013-34803035 GCACTTTTTCATGTGTTTGTTGG + Intergenic
1080730734 11:34950158-34950180 GCAACTTTGAATGGGATTGTGGG - Intronic
1081047008 11:38287818-38287840 CCAGTTTTAAATGAGGTTGTTGG - Intergenic
1081800667 11:45856927-45856949 ATACTTTTTAAAGGGATTGAGGG - Intronic
1081945316 11:46987873-46987895 CCATTTTTTGATGGGATTATTGG - Intronic
1082273234 11:50194572-50194594 CCACTTTTTGATGGGGTTGTTGG + Intergenic
1082917556 11:58453958-58453980 CCACTTTTTGATGGGGTTGTTGG + Intergenic
1083086257 11:60149332-60149354 CAACTTTTAAATTGGAATGTTGG - Intergenic
1083972869 11:66092351-66092373 CCACTTTTTGATGGGGTTGTTGG + Intronic
1084253194 11:67918707-67918729 GCACTTTTTCATGTGTTTGTTGG + Intergenic
1085881287 11:80469703-80469725 ACACTTTTTAATGTGTTTATTGG - Intergenic
1086023716 11:82263946-82263968 GCACTTTTTAATGAAATTATTGG + Intergenic
1086214586 11:84363339-84363361 CCACTTTTTGATGGGGTTGTTGG + Intronic
1086365483 11:86105726-86105748 CCACTTTTTGATGGGGTTGTTGG - Intergenic
1086461495 11:87010257-87010279 CCATTTTTTAATTGGATCATTGG - Intergenic
1086512007 11:87569082-87569104 CCACTTTTTGATGGGATTGTGGG - Intergenic
1086737479 11:90323853-90323875 CCATTTTTAAATTGGATTATTGG + Intergenic
1087216556 11:95501563-95501585 CCACATTTTGATGGGAGTGTTGG + Intergenic
1087699239 11:101416954-101416976 CCATTCTTTAATTGGATTATTGG + Intergenic
1087942497 11:104115866-104115888 CCACTTTTTGATGGGATTGTTGG + Intronic
1090699708 11:129282673-129282695 CCACTTTTGAATGGGGTCCTTGG + Intergenic
1090724768 11:129514919-129514941 CCACTTTTTGATGGAGGTGTTGG + Intergenic
1090757784 11:129808957-129808979 GCATTTTTTAATGTGTTTGTTGG - Intergenic
1092030717 12:5281566-5281588 GCATTTTTTCATGGGACTGTTGG + Intergenic
1092334162 12:7614231-7614253 CCACTTTTTAATGGGGTTGTTGG - Intergenic
1094284565 12:28778464-28778486 CCAATTTCTAATGGGAATTTAGG + Intergenic
1094635203 12:32220405-32220427 CCACTTTTTGACGGGGTTGTTGG - Intronic
1095597138 12:43972011-43972033 CCAGTTCTTAATTGGATTATTGG + Intronic
1095682013 12:44988029-44988051 CCAATTTTTGATGGGGTTGTGGG + Intergenic
1095843195 12:46716917-46716939 GCATTTTTTCATGTGATTGTTGG - Intergenic
1096719650 12:53511664-53511686 CCACTTTTTAATGGTTGGGTGGG + Intronic
1096959661 12:55565649-55565671 CCACTTTTTGATGGAGTTGTTGG - Intergenic
1097172547 12:57125495-57125517 CCACAGTTTGTTGGGATTGTTGG - Intronic
1099323185 12:81177625-81177647 CCACTTTTTGATGGGGTTGTTGG - Intronic
1100196718 12:92254550-92254572 TCACTTTTAAATGGGGTTATTGG + Intergenic
1100344158 12:93710760-93710782 CCCCTTCTTGATGGGATAGTTGG + Intronic
1100682369 12:96940929-96940951 CAACTTTTTTATGGGGTGGTGGG - Intronic
1100821481 12:98435649-98435671 CCATTTTTAAATTGGATTATTGG - Intergenic
1101183040 12:102240623-102240645 GCACTTTTTCATGTGTTTGTTGG - Intergenic
1101187667 12:102296442-102296464 GCACTTTTTCATGTGTTTGTTGG + Intergenic
1101294851 12:103411525-103411547 CCACTTCTTAATGGTATTAAGGG - Intronic
1101469698 12:104985037-104985059 ACACCTTTTCATGGGCTTGTTGG - Intergenic
1102299977 12:111764459-111764481 TCACTTTTCTATTGGATTGTTGG - Intronic
1104098736 12:125585892-125585914 ACACTTTTTAAGGGGATTCCAGG + Intronic
1104701866 12:130911056-130911078 CAACTTTATGATGGGCTTGTTGG - Intergenic
1104721989 12:131049611-131049633 GCACTGGTTAATGGGATTGCCGG + Intronic
1104793963 12:131503521-131503543 CCACTTATTGATGGGGTTGTTGG + Intergenic
1105764578 13:23546744-23546766 TCACTTTTTAATGGTGTTTTTGG + Intergenic
1106290778 13:28359698-28359720 CCATTTTTAAATAGGATTATTGG - Intronic
1106816465 13:33413666-33413688 CTATTTTCTAATTGGATTGTGGG - Intergenic
1107116143 13:36747743-36747765 ACACTCAGTAATGGGATTGTTGG + Intergenic
1107820932 13:44285117-44285139 CCACTTTTTGATGGGGTTGTTGG - Intergenic
1108161665 13:47646237-47646259 CCTATTTTTAAAGGCATTGTTGG - Intergenic
1108288572 13:48933871-48933893 CCACTTTTTGATGGAATTGTTGG + Intergenic
1108729852 13:53223785-53223807 CAGCTTTTGAATGGCATTGTCGG + Intergenic
1108928238 13:55780134-55780156 CCATTTTTTAATGGAAATATTGG - Intergenic
1109103555 13:58219271-58219293 CCATCTTTTCATGTGATTGTTGG - Intergenic
1109496807 13:63182108-63182130 CCCATTTTTCATGGGGTTGTTGG - Intergenic
1109559112 13:64023607-64023629 ACACTTTTGAATGAGATTTTAGG - Intergenic
1110088744 13:71417295-71417317 CCATTTTCTAATGGGGTTATTGG + Intergenic
1110476390 13:75919367-75919389 ACACTTTTTAGTGGAGTTGTTGG - Intergenic
1111027839 13:82555713-82555735 CCACTTTTAAATTGTATTATTGG - Intergenic
1111101469 13:83593857-83593879 CCACTTTTTAATGGGATTTTGGG + Intergenic
1111984352 13:95050626-95050648 CTACTTCTTTATGGCATTGTAGG - Intronic
1113031629 13:105999782-105999804 CCACTTTTTGATGGGGTTGTTGG - Intergenic
1114938976 14:27581791-27581813 ATACTCTTTAATGGGATTGCTGG - Intergenic
1115177789 14:30584714-30584736 CTATTTTTAAATTGGATTGTTGG + Intronic
1115897062 14:38102595-38102617 CCACTTTTTGATGGGGCTGTTGG - Intergenic
1116163017 14:41293785-41293807 CCATTTTTCAATGGGGTTGTTGG - Intergenic
1116348633 14:43829640-43829662 CCATTTTTCAAGGGGAATGTTGG + Intergenic
1116549693 14:46220953-46220975 ACACCTAGTAATGGGATTGTTGG + Intergenic
1116555057 14:46292205-46292227 ATACTTTGTAATGGGATTGCTGG + Intergenic
1116705235 14:48287506-48287528 TCACTTTTAAATGGGTTTGTAGG + Intergenic
1116994918 14:51313052-51313074 CCACTTTTTGATGGGGTTGTTGG + Intergenic
1117246481 14:53891463-53891485 CCACATTTCAATGGAATTATGGG + Intergenic
1117638525 14:57773100-57773122 GCATTTTTTCATGGGTTTGTTGG + Intronic
1117795677 14:59391218-59391240 CTACTTTTCTATGGGATTTTTGG + Intergenic
1117895643 14:60483536-60483558 CCACTATGTAAAGGGATTATAGG - Intronic
1118094428 14:62520912-62520934 CCACTTTTAAATGGGGTTGTTGG - Intergenic
1118559415 14:67062747-67062769 CCACTTTTTGATGGGTTGTTTGG + Intronic
1118688801 14:68318302-68318324 CCAATGTTTCAAGGGATTGTTGG - Intronic
1120029015 14:79618966-79618988 TCACTTTTTCATGTAATTGTTGG + Intronic
1120105373 14:80488364-80488386 CCACTTTTTCATGTGTTTCTTGG - Intronic
1120181653 14:81349398-81349420 CCACTTTTTAATGGGAAATTTGG - Intronic
1120604175 14:86552269-86552291 CCACTTTTTAATGGGGTTGTTGG - Intergenic
1120921202 14:89757035-89757057 CCAGTATATAATGGGATTGCTGG - Intergenic
1121163739 14:91771312-91771334 GCACTTTTTCATAGGCTTGTTGG - Intronic
1121722864 14:96123392-96123414 CCCCTTTTAAATTGGGTTGTTGG - Intergenic
1121848038 14:97191533-97191555 ACACTTTTTCATGTGTTTGTTGG + Intergenic
1122336874 14:100996470-100996492 CCATTTTTTAATGGGGTTGTTGG + Intergenic
1124224418 15:27879680-27879702 CCAATTTTTAATGTGGTTGTTGG + Intronic
1124471875 15:29994810-29994832 CCACTTTTTAATGGAATTATTGG - Intergenic
1125456463 15:39864849-39864871 TCACTTTTTAATGGGATTATTGG - Intronic
1125774198 15:42196479-42196501 CTACTTTTTGATGGGGTTGTTGG - Intronic
1127050586 15:55079556-55079578 CTACTTTTTGATGGGATTGTTGG - Intergenic
1127182875 15:56442113-56442135 GCACTTTTTCATGTGCTTGTTGG - Intronic
1127192149 15:56541709-56541731 GCACTTTTTAATGTGTTTTTTGG - Intergenic
1127686123 15:61346745-61346767 CCACTTTTTGAGGGGGTTGTTGG - Intergenic
1128662239 15:69510445-69510467 CCATTTTTTAATAAGATTGTTGG - Intergenic
1128849263 15:70935381-70935403 CCACTTTTTAATGGTTTTTCAGG - Intronic
1129495087 15:75972198-75972220 CCACTTTTTGATGGGGTTGTTGG + Intronic
1129498651 15:76014172-76014194 TCACTTTTTGATGGGGTTGTTGG + Intronic
1129560809 15:76565338-76565360 CCACTTTGTAATGGGGTTATTGG - Intronic
1129644453 15:77418010-77418032 ATATTTTTTAATGTGATTGTCGG + Intronic
1130039133 15:80390014-80390036 CCACTTTTTGATGGGGTTGTTGG - Intronic
1130439401 15:83936823-83936845 CCACTTTTTAAAGGGATTTTTGG - Intronic
1130724485 15:86424701-86424723 CCACTTTTTGATGGGGTTGTTGG - Intronic
1131947734 15:97645701-97645723 GCATCTTTTAATGGGATTATTGG - Intergenic
1132412475 15:101593360-101593382 CCACTTTTCGATGGGACTGTTGG + Intergenic
1133524968 16:6595817-6595839 CATCTTTTTAATGTGCTTGTTGG + Intronic
1135881989 16:26266744-26266766 CCACTTTTTGATAGGTTGGTTGG - Intergenic
1136735788 16:32466216-32466238 CCACTTTTTAATAGTAATGTTGG - Intergenic
1137957411 16:52845989-52846011 CCACTTTTTAATGGGATTATTGG + Intergenic
1137965640 16:52930268-52930290 ACACTGTTTAATGGGAATGTAGG - Intergenic
1138259422 16:55603961-55603983 CCACTTTTTGATGGGGTTGTTGG - Intergenic
1138920142 16:61517518-61517540 CCACTTTTTTCTGGGGTTGTGGG - Intergenic
1203017287 16_KI270728v1_random:363358-363380 CCACTTTTTAATAGTAATGTTGG + Intergenic
1203035622 16_KI270728v1_random:636516-636538 CCACTTTTTAATAGTAATGTTGG + Intergenic
1142934349 17:3315448-3315470 GCACTTTTTCCTGGGTTTGTCGG + Intergenic
1144156007 17:12503640-12503662 CTACTTTTTAATGGGATTATTGG - Intergenic
1145756337 17:27393529-27393551 CCATTTTTTAATCAGATTATTGG + Intergenic
1149463419 17:56853126-56853148 CCATTTTTTAATAAGATTATTGG + Intronic
1150138435 17:62708883-62708905 CCAGTTGTTTATGGGATTGCAGG + Intronic
1150344775 17:64396128-64396150 CCATTTTTCTATTGGATTGTTGG - Intronic
1150885024 17:69075076-69075098 CCACTTTTTAATGGGATTACTGG + Intergenic
1151048818 17:70952837-70952859 CCATGTTTTGATGGGATTGTTGG - Intergenic
1153887885 18:9483345-9483367 CCATTTTTGAATTGTATTGTTGG + Intronic
1155038575 18:22045779-22045801 CCATTTTTTCATGGGATTTGTGG - Intergenic
1155180801 18:23344448-23344470 CCATTTTTAAATTGGGTTGTAGG + Intronic
1155759977 18:29553181-29553203 CCACTTTTTGATGGGGTTGTTGG + Intergenic
1156169938 18:34470417-34470439 CCACTTTTTAATTGGTTATTTGG + Intergenic
1156925141 18:42568083-42568105 GCATTTTTTAATGGGTTTGTTGG - Intergenic
1157396849 18:47349056-47349078 CCACTTTTTGATGGGGTTGTTGG + Intergenic
1157602103 18:48900175-48900197 CCACATTGATATGGGATTGTTGG + Intergenic
1159302826 18:66597822-66597844 TCATTTTTTAATAGGCTTGTTGG - Intronic
1159529384 18:69636280-69636302 CCACTTTATAATGGAATATTCGG + Intronic
1160677103 19:397248-397270 CTATTTTTTAATGGGGTTGTTGG + Intergenic
1161928492 19:7319553-7319575 CCAGTTTTTAGTTGGATTATTGG + Intergenic
1163434754 19:17288797-17288819 CCACTATAAAATGGGATTATTGG + Intergenic
1164688805 19:30191628-30191650 CCACTTTTTGATGGGGTTGTTGG + Intergenic
1166419310 19:42623842-42623864 CCATTTTTTAATCGGGTTTTTGG - Intronic
1166580454 19:43893989-43894011 CCATTTTTAAATTGGATTATTGG + Intronic
1166914371 19:46185077-46185099 CTACTTTTTGATGGGGTTTTTGG + Intergenic
1168175060 19:54621435-54621457 GCATTTTTTAATGTGTTTGTTGG + Intronic
925037811 2:704638-704660 GCATTTTTTCATGGGTTTGTTGG - Intergenic
925254172 2:2468079-2468101 CCACTTTTTAAATGGAGTGTGGG - Intergenic
925798737 2:7575112-7575134 CTACTTTTTGAGGGGATTGGAGG + Intergenic
926259739 2:11248106-11248128 CCACTTTTTATTTAAATTGTAGG - Intronic
926327902 2:11800817-11800839 CCACTTTTAAATGGGATGATTGG + Intronic
926519221 2:13889306-13889328 CCACTTTTTAATCAGATTATTGG - Intergenic
928472861 2:31591248-31591270 CCACTTTTTGATGGGGTTATTGG - Intergenic
928631391 2:33196429-33196451 TAACTGTTTAATGGGAGTGTTGG + Intronic
930352335 2:50272943-50272965 CCAGTTTTTAATTGAATTTTTGG - Intronic
930396887 2:50832980-50833002 CCACTTTTAAATTGATTTGTAGG - Intronic
930611336 2:53547383-53547405 GCAATTTTAAGTGGGATTGTTGG - Intronic
930921519 2:56760702-56760724 CCACTTTTTGATGGGGTTGTTGG - Intergenic
930967874 2:57353566-57353588 ACACTTTTTGTTGGGGTTGTTGG + Intergenic
931142531 2:59478619-59478641 GCACTTTTTGATGGGGTTGTTGG - Intergenic
931338524 2:61375076-61375098 CCAGTTTTTAATTGGATTCTTGG - Intronic
931845827 2:66203065-66203087 CCATTTTCAAATGGGATAGTTGG + Intergenic
932006834 2:67935844-67935866 CCATTTTTTGATGGGGTTGTTGG - Intergenic
933421178 2:82046984-82047006 CCACTGTTTGATAGGGTTGTTGG - Intergenic
933433076 2:82209876-82209898 CCAGTTTTTGATGGGATTATTGG + Intergenic
933465635 2:82647479-82647501 CCACTTTTGAATGGAGTTGTGGG - Intergenic
933524763 2:83422072-83422094 CCACTTTTTAATGGTGGTGTTGG - Intergenic
934310033 2:91853847-91853869 TCACTTTTTAATAGTAATGTTGG + Intergenic
935494891 2:103768859-103768881 CCATTTTTCTATTGGATTGTGGG + Intergenic
935557830 2:104529786-104529808 CCACTTTTTAATAAGGTTGTTGG - Intergenic
935725290 2:106018727-106018749 CCACTTTTCTATAGGATTGTTGG - Intergenic
935834421 2:107035819-107035841 CCACTTTTAAATTGGGTTTTTGG - Intergenic
937106065 2:119313871-119313893 CTATTTTTTAATGGAATTGTAGG + Intronic
937616611 2:123930430-123930452 ACATTTTTTCATGTGATTGTTGG + Intergenic
937921295 2:127133463-127133485 CCTCTTTCTGATGGGACTGTGGG - Intergenic
938248840 2:129798372-129798394 CCACCATTTAGAGGGATTGTAGG - Intergenic
938814642 2:134888183-134888205 CCACTTTTAAATAGGATTGTTGG - Intronic
939314070 2:140524205-140524227 GCACTTTTTTATGTGTTTGTTGG - Intronic
939826064 2:147016935-147016957 CCACTTGGTAGAGGGATTGTGGG + Intergenic
939940448 2:148343604-148343626 CCAATTTTTAATGGGGCTGTTGG + Intronic
940130715 2:150378290-150378312 CCAATTTCAAATGGAATTGTTGG + Intergenic
940615723 2:156046914-156046936 CCTTTCTTTAATGGGATTATTGG - Intergenic
940718639 2:157257715-157257737 CCACCTTTTCTTGGGCTTGTAGG + Exonic
941228500 2:162879232-162879254 CCATTTTTTGATGGGGTTGTTGG - Intergenic
941502001 2:166290743-166290765 CCACTTTTTGATGGGATGCAAGG + Intronic
941593534 2:167448442-167448464 TCAATTTTTGATGGGATTGTTGG + Intergenic
943124168 2:183775873-183775895 CCACTTTTTGACGGGGTTGTTGG + Intergenic
943342680 2:186699455-186699477 CTACTTTTAAATAGGATTATTGG + Intronic
943431805 2:187812279-187812301 CCACTTTTGGATGGGATTGTTGG - Intergenic
943604893 2:189965459-189965481 CCATTTTTTGATGGGACTGTTGG - Intronic
943711273 2:191097924-191097946 CCACTTTTTGATAGGTTGGTTGG - Intronic
944002042 2:194851388-194851410 CCACTTTTTGATGGGGTTGTTGG + Intergenic
944431557 2:199639167-199639189 CCACTTTTTGATGGGATTGTTGG + Intergenic
945000140 2:205340975-205340997 GCATTTTTTAATGTAATTGTTGG - Intronic
945559046 2:211315416-211315438 CCACTTTTTAATGGAATTGTTGG - Intergenic
945758317 2:213878479-213878501 CCACTTTTTATTGGGGCTATTGG + Intronic
946649585 2:221876531-221876553 CCCATTTTTAATGGGATTATTGG + Intergenic
947511167 2:230755471-230755493 CCACTTTTTGATGGGATTATTGG + Intronic
948553844 2:238794145-238794167 CCACTCTTTCATGGAATTCTGGG - Intergenic
948738055 2:240023311-240023333 CCACTTTTTCATGTGGTTTTTGG - Intronic
1169742101 20:8906195-8906217 CCACATTTTAATAAGATTCTGGG + Intronic
1173044396 20:39495570-39495592 CCACTTTTTAATAGGATATTTGG - Intergenic
1173197376 20:40926771-40926793 CCCATTTTTTATTGGATTGTTGG - Intergenic
1174092749 20:48062472-48062494 ACACTTTCTAATTGGAATGTAGG - Intergenic
1176324015 21:5369300-5369322 CCACTTTTTGAAGGGGTTGTTGG - Intergenic
1176481774 21:7303307-7303329 CCACTTTTTGAAGGGGTTGTTGG - Intergenic
1177287350 21:19069383-19069405 CCACTTTTTGGTGGAATTTTTGG - Intergenic
1177473645 21:21591272-21591294 GCAATTTTTAATGTGATTATTGG - Intergenic
1177586590 21:23103338-23103360 ACAATTTTTAAAGGGATTTTAGG + Intergenic
1178017009 21:28358754-28358776 CAACTTCTAAATGGGATTGATGG - Intergenic
1178219482 21:30639905-30639927 CCACTTGTTGATGGGGTTGTTGG + Intergenic
1179055494 21:37928221-37928243 CCCATTTTTAATGGTTTTGTGGG + Intergenic
1179362091 21:40719188-40719210 GCACTTTTTAATGTGCTTATTGG - Intronic
1180536771 22:16399731-16399753 TCACTTTTTAATAGTAATGTTGG + Intergenic
1180604979 22:17051488-17051510 ACACTTTTTAATGTGCTTATTGG - Intergenic
1182170831 22:28227526-28227548 CCATTTTTGAATTGGGTTGTAGG - Intronic
1182378315 22:29865267-29865289 CCACTTTCTAGTTGGATTGTTGG + Intergenic
1183114955 22:35684724-35684746 CCACTTTTCAGTGTGATTTTGGG + Intergenic
1185064720 22:48625732-48625754 TCACTCTTTAGTGGAATTGTGGG + Intronic
949243482 3:1898008-1898030 CCACTTGTTAGTGAGAATGTAGG + Intergenic
949724759 3:7031353-7031375 CCAGGTTTTAATGGGATTCAAGG - Intronic
950378608 3:12592400-12592422 TTACTTTTTAATGGTATTGAAGG - Intronic
951127874 3:19005261-19005283 CCACTTTTTGGTGGGGTTGTTGG - Intergenic
951164798 3:19472123-19472145 TCTTTTTTTAATGGGATTGCTGG + Intronic
951757517 3:26107533-26107555 CCACTTTTTAATGTGGTTATTGG + Intergenic
951856705 3:27205139-27205161 CCACTTTTTGATGGGGTTGAAGG + Intronic
952630391 3:35458371-35458393 CCACTTTTTGATGTGGTTGCTGG + Intergenic
954445525 3:50544564-50544586 CCATTTCTCAATGGGATTCTTGG - Intergenic
954769950 3:52958122-52958144 CCGCTTTTTAATGGGGTTGTTGG - Intronic
955293060 3:57710750-57710772 CCATTTTTGAATTGGGTTGTTGG - Intergenic
955834371 3:63038543-63038565 CCACTTTTTAATGGGGTTATTGG + Intergenic
957652783 3:83030700-83030722 GCATTTTTTCATGGGTTTGTTGG - Intergenic
957942477 3:87022379-87022401 CCACTTGTTGATGGGGTTGTTGG - Intergenic
957986921 3:87584003-87584025 CCACTGTAAAATGGGCTTGTGGG - Intergenic
958107295 3:89092427-89092449 CCACTTTTTGATGGGGTTGTTGG + Intergenic
958117779 3:89243584-89243606 CCACTTTTTGATGGGGTTGTTGG + Intronic
958618166 3:96523174-96523196 CCATTTTTTAATCAAATTGTTGG + Intergenic
958660652 3:97062493-97062515 CCACTTCTTAATAGGATTATTGG - Intronic
958770496 3:98420593-98420615 CCACTTTTTAATGAGATTATTGG - Intergenic
958840790 3:99202541-99202563 ACTCTTTATAATGGGATTATAGG + Intergenic
958953947 3:100446762-100446784 CCACTTTTTGATGGGGTTGTTGG - Intronic
959239109 3:103765954-103765976 TCATTTTTTAATGTGTTTGTTGG - Intergenic
959360913 3:105390427-105390449 CCACTTTTTAATGGGGTTGTTGG + Intronic
960206927 3:114913413-114913435 CCATTTTTTATTTGGATTATTGG + Intronic
960495795 3:118373451-118373473 CCACATTTTAATGGGGTTATTGG + Intergenic
960762228 3:121085045-121085067 CCACTGTTTGATGGGGTTGATGG + Intronic
961993707 3:131218881-131218903 CCACTTTTTGATAGGGTTGCTGG + Intronic
962001278 3:131300209-131300231 ACACTTTTTAATGGGGTTGTTGG + Intronic
962591836 3:136897555-136897577 CTACTTTTAAATGGGATTATTGG + Intronic
963487159 3:145949401-145949423 TCACTTTTTAATGGGGTTGTTGG - Intergenic
963514233 3:146288728-146288750 CCATTTTTTGATGGGGTTGTTGG + Intergenic
963619992 3:147594659-147594681 CCACTTGTTGATGGGATTGTTGG + Intergenic
963763958 3:149314245-149314267 CCACTTTTAAATGAGGTTTTTGG - Intergenic
963813517 3:149804030-149804052 CCACTTTGTGATGGGGTTGTTGG + Intronic
964016164 3:151949721-151949743 CCACTTTTTAATGGGGTTGTTGG - Intergenic
965808632 3:172569117-172569139 CCATTTTTTGATTGGATTATTGG + Intergenic
966016699 3:175148277-175148299 CTACTTTTTAATGGGGTTATTGG + Intronic
966108918 3:176373242-176373264 CCATTTTTTAATCAGATTGTTGG - Intergenic
966826406 3:183968581-183968603 CTACTTTTTTGTGGGATTGATGG - Intronic
968354406 3:198093039-198093061 CCATTTTTTAATGGGGTTATTGG + Intergenic
970014638 4:11499705-11499727 CCACTTTTTGATGGGGTTGATGG + Intergenic
970025295 4:11617427-11617449 CCACTTTTTAGTTGGGCTGTTGG + Intergenic
970794621 4:19896408-19896430 ACACTCAGTAATGGGATTGTTGG - Intergenic
970861480 4:20708479-20708501 CTAGTTTTTAATGGTATTTTCGG + Intronic
970874495 4:20853806-20853828 TTACTTTTTGATGGGATTGTTGG - Intronic
971672844 4:29586034-29586056 CCACGTTTTGATGGGGTTGTTGG + Intergenic
971709240 4:30090365-30090387 GCACTTTTTCATATGATTGTTGG - Intergenic
971868859 4:32209447-32209469 CCACTTTTTAATGGGGTTGTTGG + Intergenic
973034219 4:45385546-45385568 ACACTTTTTCATGTGTTTGTTGG + Intergenic
973561131 4:52137211-52137233 CCACTTTTTAATGGGGCTGTTGG - Intergenic
973617919 4:52698086-52698108 CCATTTTTTTATATGATTGTTGG - Intergenic
973642651 4:52918524-52918546 ACACTTTTTAATGGGATTATGGG - Intronic
973904375 4:55512410-55512432 CCATTTTTTAACTGGTTTGTTGG + Intronic
973966432 4:56167051-56167073 CAAAGTTTTAGTGGGATTGTGGG + Intergenic
974085666 4:57258027-57258049 CCACTTTTTAATAGCATTGTTGG + Intergenic
974230632 4:59109430-59109452 CCACTTTTTGATGGGGTTGTTGG + Intergenic
974473525 4:62350382-62350404 CCAATTTTTAGTAGGATTTTAGG + Intergenic
974579348 4:63775552-63775574 ACACATTTTAATGGAATTTTAGG - Intergenic
974633606 4:64529163-64529185 ACAATTTTTAATGGGGTTGTTGG - Intergenic
974834193 4:67227549-67227571 ACACTTTTTCATATGATTGTTGG - Intergenic
975036847 4:69694930-69694952 CCACTTTTTGATGGGGTGGTTGG + Intergenic
975178406 4:71314083-71314105 CCACTTTTTGATGGGGTTGTTGG - Intronic
975968315 4:80002722-80002744 CCACTTTTTGATAGGGTTGTTGG - Intronic
976015474 4:80547687-80547709 CCATTTTTTGATGGGGTTATTGG - Intronic
976363828 4:84211250-84211272 CCACTTTTTGGTGGGATTATTGG - Intergenic
976687172 4:87826822-87826844 CCACTTTTTAATGGGGCTGTTGG + Intronic
977056197 4:92194962-92194984 CCACTTTTTCTTGGGAATGTCGG + Intergenic
977167245 4:93714759-93714781 CCACTTTTTAATGGAGTTGTTGG + Intronic
977199133 4:94094886-94094908 CCACTTTTTAATGGGGTTGTGGG + Intergenic
977445752 4:97129766-97129788 CCACATTTTAATGGGGTTGTTGG - Intergenic
977461065 4:97325864-97325886 CCACTTTTTGATGGGGTTGTTGG + Intronic
977829593 4:101575026-101575048 CCACTTTTACATGGGATTATCGG + Intronic
977980133 4:103311376-103311398 CCACTTTTTGATGGGGTTGTTGG + Intergenic
977999409 4:103538655-103538677 CCACGTTTTGATGGGGTTGTTGG + Intergenic
978098256 4:104805836-104805858 CCACTTTTTGATGGGGTTGTTGG - Intergenic
978214397 4:106181197-106181219 CCATTTTTTGATGGGGTTCTTGG + Intronic
978352097 4:107830705-107830727 CCATTTTTTAATGGGGTTGTTGG + Intronic
978580372 4:110226091-110226113 CCCCATTTTAATGGAAATGTAGG + Intergenic
979096632 4:116559220-116559242 ATACTTAGTAATGGGATTGTTGG - Intergenic
979185533 4:117786906-117786928 CCACTTTTTTATGTGTTTGTTGG + Intergenic
979263537 4:118675080-118675102 CCATTTTGTAATAGGATTTTTGG + Intergenic
981228180 4:142321229-142321251 GCACTTTTTCATAGGCTTGTTGG + Intronic
981299703 4:143173108-143173130 CCACTTTTCTATGGAGTTGTTGG + Intergenic
981523629 4:145690790-145690812 GCACTTTTTGATGGGTTTGTTGG - Intronic
981752599 4:148107173-148107195 CCACTTTTTGATGGGGTTTTTGG - Intronic
982196779 4:152924171-152924193 CCACTTTTTGATGGGGTTGTTGG - Intergenic
982509714 4:156266257-156266279 CCACTTTTTAATGGGATTTTGGG + Intergenic
982850703 4:160311830-160311852 ACATTTTTTAATACGATTGTTGG + Intergenic
983045679 4:162983977-162983999 CTAGTTTTTACTGTGATTGTGGG + Intergenic
983263562 4:165483796-165483818 CCACTTTTTAATGGGGTTGTTGG + Intronic
983473956 4:168192456-168192478 CCAATTTTTAATGGGACTATTGG - Intergenic
984014743 4:174412726-174412748 CCACTTTTTGATGGGATTGTTGG + Intergenic
984135529 4:175933133-175933155 CCCATTTTTAATGGAGTTGTTGG - Intronic
984325878 4:178249697-178249719 TCACTTTTTGATGGGGTTGTTGG + Intergenic
985312141 4:188614091-188614113 CCTTTTTTTTGTGGGATTGTTGG - Intergenic
985356676 4:189127104-189127126 TCACTTTTTAATGGAGTTGCTGG + Intergenic
985392758 4:189507637-189507659 CTAATTTTTAATTGGGTTGTTGG + Intergenic
985798066 5:1979343-1979365 CCACTTTTAAATTGGGTTTTTGG - Intergenic
985955113 5:3259737-3259759 CCACTTCTTAATATGATTGAGGG - Intergenic
986607435 5:9536123-9536145 CCACTTTTACATGGGTTTGGGGG + Intronic
986617474 5:9633773-9633795 CCATGTTTTGATGGGATTATTGG + Intronic
986670899 5:10141491-10141513 CCACCTGTTAATGGGATTATTGG - Intergenic
986714850 5:10515971-10515993 CCATTTTTGAATTGGGTTGTTGG - Intronic
986878249 5:12137494-12137516 CCACTTCTAAAAGGGATTGTTGG - Intergenic
987351869 5:17029540-17029562 CCACTTTTTAATGGGATTGTTGG - Intergenic
987443080 5:17981905-17981927 CCACTTTTTAATGGGGTTGTTGG - Intergenic
987639202 5:20589802-20589824 CCACTGTATAATTGGCTTGTGGG + Intergenic
987684694 5:21182168-21182190 CCACTTTTCTATGGGATAGCTGG - Intergenic
988675169 5:33425731-33425753 CCACTTTTTAATGGGGTTGTTGG + Intergenic
989447788 5:41551230-41551252 ATACTGATTAATGGGATTGTTGG - Intergenic
989945569 5:50223439-50223461 CCACTTTTTGATGGGGTTGTTGG - Intergenic
990223822 5:53626710-53626732 CCACTTTTTGATGGGGCTGTTGG + Intronic
990336900 5:54783131-54783153 CCACTTTTTAATGAGGTTGTTGG - Intergenic
990619503 5:57544486-57544508 TCACTTTTTGATGGGATTGTTGG + Intergenic
990891322 5:60653361-60653383 CCATTTTTTCATGTGTTTGTGGG + Intronic
991169117 5:63600316-63600338 CCACTTTTTGATGGGGTTATTGG + Intergenic
992564304 5:77982864-77982886 CCTGTTTTTAATTGGCTTGTTGG + Intergenic
992815441 5:80432753-80432775 CCACTTGTTGATGGGGTTGTTGG - Intronic
993249300 5:85496808-85496830 ATACTTATTAATGGGATTGCTGG + Intergenic
993331819 5:86609943-86609965 CCATTTTTTCATGTGCTTGTTGG + Intergenic
994015655 5:94962023-94962045 CCATTTTTTCATGTGTTTGTTGG - Intronic
994288319 5:97996608-97996630 CCACTTTTAGATGGGGTTGTTGG - Intergenic
994310257 5:98261017-98261039 CTACATTTTTAAGGGATTGTGGG + Intergenic
994480457 5:100327771-100327793 TCACTTCTTGATGGGATTTTTGG + Intergenic
994541095 5:101098665-101098687 GCACTTTTTCATGTGCTTGTTGG - Intergenic
996055519 5:118978539-118978561 CCGCTTCTTAATGGGGTTGTTGG - Intronic
996526521 5:124485985-124486007 CCACTTTTTGATAGGGTTGTTGG + Intergenic
997017740 5:129956385-129956407 CCACTTTTTAATGGAGCTGTTGG + Intronic
997221035 5:132164663-132164685 CCACTTTTAAATTGAGTTGTTGG + Intergenic
997636761 5:135414831-135414853 GCACTTTTTCATGGGCTTATTGG + Intergenic
998415088 5:141940445-141940467 CCACTCAGTCATGGGATTGTGGG - Exonic
998724910 5:145000818-145000840 CCATTTTTTAATTGGATGTTTGG + Intergenic
998932634 5:147198450-147198472 CCACTTCTTGATGGAGTTGTTGG - Intergenic
999114043 5:149146127-149146149 CCACTTTTTAATGGTTTTTGGGG + Intronic
999442176 5:151610965-151610987 ACACGATGTAATGGGATTGTTGG - Intergenic
1000155588 5:158548330-158548352 CCACTTTTTGATGGGGTTGTCGG + Intergenic
1000194513 5:158944898-158944920 CCACTTTTTGATGGGGTTGTTGG + Intronic
1000387686 5:160690517-160690539 CCACTTTTTGATGGGATTGTTGG - Intronic
1000642492 5:163719120-163719142 CCACTTTTTAAGGGAGTTGTTGG - Intergenic
1000649973 5:163805002-163805024 ATACTATTTAATGGCATTGTTGG + Intergenic
1000654024 5:163854252-163854274 CCACTTTTTGATGGGGTTGTTGG - Intergenic
1001348155 5:170928177-170928199 CCATTTTTAAATTGGATTGTTGG + Intronic
1001357712 5:171046966-171046988 TGCCATTTTAATGGGATTGTAGG + Intronic
1001632357 5:173185090-173185112 CCACTCTTTGATGGGATTGTTGG - Intergenic
1005107762 6:22243802-22243824 CCACTTTTTGATGGGATTGTGGG - Intergenic
1005448100 6:25946172-25946194 CCACTTTTTAAATGAATTGTTGG + Intergenic
1005796716 6:29370745-29370767 CCATTTATTAATGGGATTATTGG + Intronic
1006427277 6:33974178-33974200 TCCCTTTTTATTGGGATTGTTGG - Intergenic
1007267150 6:40605238-40605260 TCAATTTTTAATGGGGTTGAGGG - Intergenic
1008202545 6:48609316-48609338 CCACTTTTTGATCGGATTATTGG + Intergenic
1008269892 6:49479292-49479314 CCACTTTTTAATAGGATTGTTGG - Intronic
1009319484 6:62269391-62269413 AAAATTTTTAATTGGATTGTGGG - Intronic
1009352735 6:62702356-62702378 CCATCTTTTAATTGGATTGTTGG + Intergenic
1009459245 6:63892892-63892914 CTACTTTTGGATGGGGTTGTTGG - Intronic
1009558569 6:65208115-65208137 CCACTTTTTAATGGGATTGTTGG - Intronic
1009673916 6:66791961-66791983 TCTCTTTTGAATGGTATTGTTGG - Intergenic
1009877457 6:69522619-69522641 CCATTTTTTAATGGGGTTGTTGG - Intergenic
1010338052 6:74712396-74712418 CATTTTTTTTATGGGATTGTTGG - Intergenic
1010530098 6:76958157-76958179 CAACTTTTTAATGAGGTTGTTGG - Intergenic
1010692543 6:78927374-78927396 CCATTTTTAAATCGGATTATTGG + Intronic
1010931328 6:81807235-81807257 CCACCTCTTAATGGGAGTCTGGG + Intergenic
1011138299 6:84123944-84123966 CCACTTTTTCACGTGTTTGTTGG - Intergenic
1012008245 6:93744324-93744346 CCACTTTTTAGTGAGGTTATTGG + Intergenic
1012738251 6:102978652-102978674 CCACTTTTTGATGGAATTGTTGG - Intergenic
1013628700 6:111963335-111963357 CCACTTTTTCAAGTGCTTGTTGG + Intergenic
1013870363 6:114750960-114750982 CAACTTTTTAATGTAAATGTTGG + Intergenic
1014060931 6:117070859-117070881 CCACTTTTTAATGAGATTATTGG + Intergenic
1014132677 6:117852513-117852535 CCACTTGTTGATGGGGTTGTTGG + Intergenic
1014348707 6:120310839-120310861 GCACTTTTTAATATGCTTGTTGG + Intergenic
1014391415 6:120871007-120871029 TTACATTTTAGTGGGATTGTTGG - Intergenic
1015212926 6:130718355-130718377 CCACTTTTTAATGGTTTAATGGG - Intergenic
1015418743 6:132981919-132981941 CCACTTTTTGATGGGATTGTTGG + Intergenic
1015486382 6:133774775-133774797 CCAATTTCTACTGGGAGTGTGGG + Intergenic
1015691404 6:135927946-135927968 CCAATTTTTAATGGGATTATTGG - Intronic
1016542847 6:145185648-145185670 CCATTTTTTAATCGGGTTATTGG - Intergenic
1016784636 6:147996824-147996846 ACACTTTTTAATGAAATTATTGG + Intergenic
1016791591 6:148072022-148072044 CCACTTTTTGATGGGGTTGTTGG + Intergenic
1017664770 6:156709010-156709032 CATCATTTTAATGGGATTTTGGG - Intergenic
1018115569 6:160580672-160580694 GCACTTTTTCAGGTGATTGTTGG + Intronic
1018913488 6:168117974-168117996 TCACTTTTTTATGGAATTATGGG + Intergenic
1019940657 7:4286753-4286775 CCATTTTCTAATTGGATTGTTGG + Intergenic
1020253840 7:6490508-6490530 TCACTTTTTGCTGGGATTATAGG + Intergenic
1020604619 7:10320923-10320945 CCATTTTGTAATGAGATTCTGGG + Intergenic
1021243310 7:18231643-18231665 CCACTTTTTGATAAGATTATGGG + Intronic
1021305939 7:19032675-19032697 CCACTTTTTGATGGGGTTGTTGG - Intronic
1022079263 7:27003208-27003230 GCACTTTTTCATGTGACTGTTGG + Intergenic
1022210723 7:28206458-28206480 CCACTTTTACATAGAATTGTTGG + Intergenic
1022765708 7:33408721-33408743 GTACTCTGTAATGGGATTGTTGG + Intronic
1022777520 7:33543221-33543243 CCATTTTTTCATAGGTTTGTTGG + Intronic
1022986554 7:35660707-35660729 CCACTTGTTGATGGGGTTGTTGG + Intronic
1023288072 7:38639943-38639965 CCATTTTTTAAATGGGTTGTTGG - Intergenic
1024499649 7:50091143-50091165 CCACTTTTTGATGGGACTGTTGG + Intronic
1024789429 7:52947393-52947415 ACACTTATTAGTGGGATTGCTGG - Intergenic
1025771631 7:64512712-64512734 CCAGTTTTTAACTGGATTATTGG - Intergenic
1027465579 7:78511032-78511054 ACACTTTTTAATGGGATTATTGG - Intronic
1027468613 7:78545622-78545644 CCGCTATTTAATGACATTGTTGG + Intronic
1028155749 7:87427470-87427492 TCTCTTTTTAATGGGAATGGGGG + Intronic
1028984783 7:97001227-97001249 CCACTTTTTAACTGGATTTGGGG + Intergenic
1029112358 7:98219557-98219579 CCACTTTTGGATGGGATTATTGG - Intronic
1030021845 7:105282954-105282976 CCACTTTATCATTGGGTTGTTGG - Intronic
1030247117 7:107395219-107395241 CGTCTTTTTAATGTGATTCTGGG - Intronic
1030579132 7:111330737-111330759 CCATTTTTAAATTGGATTTTTGG - Intronic
1030669187 7:112316301-112316323 CCACTTTTTGAAGGGTTTGTTGG + Intronic
1030731790 7:112998957-112998979 CCACATTTTAATAGGGTTGTTGG - Intergenic
1030854475 7:114535986-114536008 CCAATTTATAATGGGAGCGTAGG + Intronic
1031023934 7:116659940-116659962 CCACTTTTTAATGGAATTGTTGG + Intergenic
1031282924 7:119827587-119827609 CCCATTTTTAGTGGGATTGTTGG + Intergenic
1031399413 7:121313827-121313849 CCACTTTTTAATGCTGTTTTGGG - Intergenic
1031472265 7:122181169-122181191 CCAATTTTTAATGGGATTATTGG + Intergenic
1031811280 7:126372457-126372479 CCCATTTTTAATGGGGTTTTTGG - Intergenic
1031879657 7:127182225-127182247 GCATTTTTTAATGTGTTTGTTGG - Intronic
1032941904 7:136803609-136803631 CCATTTTTTAATTGGGCTGTTGG - Intergenic
1033980960 7:147165328-147165350 CTACTTTTTGATGGGATTGTTGG + Intronic
1034715978 7:153241995-153242017 ACACTTTTTGGTGGGATTGTTGG + Intergenic
1034757511 7:153636577-153636599 CCATTTTTTAATTGGATTATTGG + Intergenic
1036005710 8:4660783-4660805 CCATTTTCTAATTGGATTGTTGG - Intronic
1036019320 8:4825812-4825834 CCATTTCTTAATTGGATTGTGGG - Intronic
1036098467 8:5751201-5751223 CCACTTTTTACAGGCATTGATGG + Intergenic
1036193348 8:6691854-6691876 ACACTTAGTAATGGGATTGCTGG + Intergenic
1036954431 8:13172017-13172039 CGACTTTTTAATGGTAGTGATGG - Intronic
1038171408 8:25136931-25136953 CCCATTTTTAATGGGGTTATTGG + Intergenic
1040531961 8:48273399-48273421 CCACTTTTTGATGTGATTGTTGG - Intergenic
1040608079 8:48954732-48954754 CCACTTTGTGATGGGTTTGTTGG + Intergenic
1041150721 8:54930647-54930669 CCACATTTTGATGGAATTTTTGG - Intergenic
1041888037 8:62835502-62835524 CCACTTTTTAATGGGATTACTGG - Intronic
1042013551 8:64279906-64279928 TCATTTTTTAATGGTATTGGGGG + Intergenic
1042871319 8:73402543-73402565 CCACTTTTTAATAGGTTGTTTGG - Intergenic
1043340760 8:79235514-79235536 CCACTTTTTAATGAGGTTATTGG - Intergenic
1043788925 8:84438089-84438111 TCACTTTTTAATGGGGTGATTGG + Intronic
1044355776 8:91221198-91221220 CCACTTTTTGATGGGGTTGTTGG + Intronic
1044748408 8:95393660-95393682 CCTCTTCTTGATGGGATTGATGG + Intergenic
1045141393 8:99288280-99288302 CCAGTGCTTAATGGGATTATGGG + Intronic
1045210237 8:100090044-100090066 TCACTGTTTAATGGGATTGGTGG - Intronic
1046176354 8:110580250-110580272 CCATTGTTTAATGGGATTATTGG + Intergenic
1046295078 8:112208260-112208282 TCACTTTTAAATGGTATTGCAGG - Intergenic
1046409440 8:113820071-113820093 CCACTTTTCTATGGGGTTTTTGG + Intergenic
1047081377 8:121464981-121465003 CTACTTTTTAATGGGGTTAATGG + Intergenic
1048065605 8:130965003-130965025 CCACTTTTTAAAGGGTTATTTGG + Intronic
1048173301 8:132129256-132129278 CCTCTTTTAAATGGGCTTATTGG + Exonic
1048669231 8:136697288-136697310 ACACTTTTTAATGGGGTTGTTGG + Intergenic
1050232114 9:3537575-3537597 CCACTTTTTGATGGGATGGTTGG + Intergenic
1050423050 9:5487059-5487081 CCAATTTTAAATGGGATGGCTGG + Intergenic
1051826152 9:21222529-21222551 CCACTTTTTGATGGGGTTGTTGG - Intronic
1052039585 9:23723001-23723023 CTGCTTTTTAAGGGGAATGTGGG - Intronic
1052212715 9:25926209-25926231 CCACCTTTTAATTGGGTTATTGG - Intergenic
1052249199 9:26377496-26377518 CCATTTTTTCATGGGTCTGTTGG + Intergenic
1052506021 9:29355605-29355627 CCACTTTTTGATGGGGTTGTTGG + Intergenic
1052514207 9:29459253-29459275 CCAGTTTTTGATGGAATTGTTGG + Intergenic
1052614352 9:30819476-30819498 ATACTTTTTAATGGCTTTGTAGG + Intergenic
1052642053 9:31181227-31181249 CCACTTTTTGATGGGGTTGTTGG - Intergenic
1052651108 9:31302481-31302503 CCATTTTTTAATGTGCTTGCTGG - Intergenic
1052659578 9:31411045-31411067 CCACTTTTTGGTGGGGTTGTTGG - Intergenic
1053568517 9:39279109-39279131 CCACTTTTTGATGGGATTGTTGG - Intronic
1054128629 9:61339898-61339920 CCACTTTTTGATGGGATTGTTGG + Intergenic
1055005157 9:71497725-71497747 CCACTTTTTGATGGGGTTGTTGG - Intergenic
1055401296 9:75927102-75927124 CCAAGTTTTAATGAGATTGTGGG - Intronic
1055537445 9:77263574-77263596 CTACTTTTTGATGGGGTTGTTGG + Intronic
1055591696 9:77822476-77822498 CCTCTGGTTAATGAGATTGTAGG - Intronic
1055944773 9:81683119-81683141 CCACCTTTCAACGGGTTTGTCGG - Intronic
1056027080 9:82509986-82510008 GCACTTTTTCATGTGTTTGTTGG - Intergenic
1056050918 9:82768031-82768053 TCATTTTCTAATTGGATTGTTGG + Intergenic
1056412689 9:86347319-86347341 CAACTTGTTAAAGTGATTGTGGG + Intronic
1056585595 9:87925368-87925390 CCACTTTTGACTGGGCTTTTGGG + Intergenic
1056611285 9:88127576-88127598 CCACTTTTGACTGGGCTTTTGGG - Intergenic
1057281440 9:93714734-93714756 CCATTTTCTAATTGGTTTGTTGG + Intergenic
1057675370 9:97132906-97132928 CCACTTTTGACTGGGACTTTGGG + Intergenic
1058077892 9:100668907-100668929 CCATTTTTTAATTGAATTATGGG - Intergenic
1058327262 9:103714489-103714511 CCACTTTTTAATGGAGTTGTTGG - Intergenic
1059499364 9:114737892-114737914 GTCCTTTTTAATGGGATTTTTGG - Intergenic
1059747014 9:117212599-117212621 CCACTTTTTTATTAGATTGGAGG - Intronic
1060020256 9:120124086-120124108 CCACTTTTTGATGGGGTTGTTGG - Intergenic
1185961696 X:4551885-4551907 CAATTTTTTAATTGGATTGTTGG - Intergenic
1186997947 X:15143683-15143705 CCCCTTTTTATTGGGAGTTTGGG + Intergenic
1187607381 X:20900591-20900613 CCACTTTTTAATGGGGTTGTTGG + Intergenic
1187801946 X:23073736-23073758 CCATTTTTTAATGGGGTTGTTGG - Intergenic
1187847019 X:23550272-23550294 CCACTTTTTAATCAGATTTGGGG + Intergenic
1188172630 X:26946695-26946717 CCTCATTTTAATGAGGTTGTCGG + Intergenic
1188229736 X:27646720-27646742 CCACTTTTTAATGCGGTTGTTGG - Intronic
1188819494 X:34756790-34756812 CTACTTTTTAATTGGCTTCTAGG + Intergenic
1188926306 X:36048878-36048900 CCATATTTTAATGGCATTTTTGG + Intronic
1188975865 X:36674893-36674915 CCAGTTTTTCATATGATTGTTGG + Intergenic
1189173107 X:38928306-38928328 CCACATTTTCATTGGCTTGTCGG + Intergenic
1189493686 X:41490323-41490345 CCATTTTCTAATTGCATTGTTGG - Intergenic
1189847345 X:45149565-45149587 CCATTTTTGAATGGGAGTGAAGG + Exonic
1189921365 X:45906126-45906148 CCGCTTTTTCATGGGGTCGTTGG + Intergenic
1190812077 X:53894658-53894680 ACACTTTTTAATGAGGCTGTTGG - Intergenic
1191145254 X:57158608-57158630 GCACTTTTTAATGTGTCTGTTGG + Intergenic
1191224111 X:58022887-58022909 ACACTTAGTAATGGGATTGCTGG - Intergenic
1191694932 X:63979504-63979526 CCACTTTGTGTTGGGATTGAAGG - Intergenic
1191823053 X:65334670-65334692 CCAATTTTTAATTGGATTACTGG + Intergenic
1191959215 X:66681210-66681232 CCACTTTTTCATATGCTTGTTGG + Intergenic
1191961385 X:66706707-66706729 CCACTTCTTACAGGGATAGTTGG - Intergenic
1192135621 X:68596766-68596788 CCAGTTTTTAATCGTATTATTGG - Intergenic
1192722742 X:73716780-73716802 CCACTTTTTAATGGGCTTATTGG + Intergenic
1192858853 X:75043821-75043843 CCACTTTTTGATGGGTTGTTTGG - Intergenic
1192969285 X:76214481-76214503 CCACTTTTTGATGAGGTTGTTGG - Intergenic
1193119551 X:77808913-77808935 CCATTTTTTCATGTGTTTGTTGG + Intergenic
1193119561 X:77808982-77809004 CCACTTTTTGACGGGATTATTGG + Intergenic
1193192322 X:78585929-78585951 CCAATTTTTAATTGGATTATTGG + Intergenic
1193301635 X:79896029-79896051 CAACTTTTTAATGGGTTGTTTGG - Intergenic
1193408427 X:81133083-81133105 GCTTTTTTTAATGTGATTGTTGG - Intronic
1193491486 X:82154777-82154799 ATACTCTATAATGGGATTGTTGG - Intergenic
1193552813 X:82919339-82919361 CCACTTTGTAATGGGATTGTTGG + Intergenic
1193560429 X:83010949-83010971 CAAGTTTTTAATTGGATTGTAGG + Intergenic
1193684521 X:84560838-84560860 CCACTTTTTGATGGGGTTGTTGG - Intergenic
1193773280 X:85613346-85613368 CCCATTTTTAATGGGGTTATTGG + Intergenic
1194355872 X:92883248-92883270 CCACTGTTTAATGAGGTTGTTGG - Intergenic
1194462255 X:94185960-94185982 CTACTTTTTAATGGGGTTGTTGG + Intergenic
1194529643 X:95029558-95029580 CCTATTTTTAATGAGGTTGTTGG + Intergenic
1194780968 X:98025103-98025125 CCACTTTGTTATGGGGTTGTTGG + Intergenic
1194900290 X:99501188-99501210 CTACTTTTTAATGGGGCTGTTGG - Intergenic
1194967765 X:100308690-100308712 CCACTTTTTGATGGGATTGTTGG - Intronic
1195018961 X:100807032-100807054 CCACTTTTTGATGGGATTGTGGG + Intergenic
1195145078 X:102005763-102005785 CCACTTTTTAACGGGTTGTTTGG - Intergenic
1195145722 X:102015140-102015162 CCATTTTTTAATTGCATTGTTGG - Intergenic
1195353557 X:104016759-104016781 CCATTTTTTAATGGGGTTGTTGG + Intergenic
1195501504 X:105606215-105606237 CCCATTTTTAATGGAATTATTGG - Intronic
1195602089 X:106761079-106761101 CCAGTTTTTAATGGGGTTGTTGG - Intronic
1195783868 X:108495509-108495531 CCATTTTCTAATGGGATTTGGGG - Intronic
1195784985 X:108509469-108509491 CCACTTATTAATGAGGTTGTTGG - Intronic
1195878179 X:109564059-109564081 GCACCTTTTAATGGGGTTTTAGG - Intergenic
1196546073 X:116965591-116965613 CCATTTTTTCATGTGATTTTTGG + Intergenic
1196564991 X:117194720-117194742 CCATTTTTAAATTGGATTATTGG - Intergenic
1196682286 X:118481475-118481497 CCATTTTTAAATTAGATTGTTGG + Intergenic
1196982080 X:121225805-121225827 CTACTCTTTAATGAGGTTGTTGG + Intergenic
1197166221 X:123380474-123380496 CCACTTTTTGATGGGGTTGTTGG + Intronic
1197433139 X:126391320-126391342 CCACTTTTTTATGAGGTTGGTGG - Intergenic
1197625515 X:128797893-128797915 CCATTTCTTAATGGGGCTGTTGG - Intergenic
1198384462 X:136115275-136115297 CAACTTTTGAATGGTATTGTAGG + Intergenic
1198889897 X:141382320-141382342 CCAATTTTTGATGGGATTATTGG - Intergenic
1199397507 X:147356782-147356804 CCACTTTTTAATGGAACTATTGG - Intergenic
1199427958 X:147724847-147724869 CCCATTTTTAATGAGGTTGTTGG + Intergenic
1199479177 X:148279025-148279047 CCACTTTTTAATGAGGCTGTTGG - Intergenic
1199821284 X:151450726-151450748 CCACTTTTTGATGGGATTGTTGG + Intergenic
1199901008 X:152172188-152172210 CCATCTTTTCATGTGATTGTTGG - Intronic
1200358439 X:155577235-155577257 GCACTTTTTTATGTGCTTGTTGG - Intronic
1200664218 Y:6000225-6000247 CCACTGTTTAATGAGGTTGTTGG - Intergenic
1201641223 Y:16179078-16179100 CCACTTTTTGATGGGGTTGTTGG - Intergenic
1201661593 Y:16406244-16406266 CCACTTTTTGATGGGGTTGTTGG + Intergenic
1201983582 Y:19935546-19935568 CTACCTAATAATGGGATTGTTGG - Intergenic
1202331819 Y:23761625-23761647 CCACTTTTTGATGGGGTTGTTGG - Intergenic
1202538951 Y:25908435-25908457 CCACTTTTTGATGGGGTTGTTGG + Intergenic