ID: 987351872

View in Genome Browser
Species Human (GRCh38)
Location 5:17029548-17029570
Sequence CCATTTGCCCACTTTTTAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26886
Summary {0: 13, 1: 204, 2: 2132, 3: 10666, 4: 13871}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987351872_987351877 -10 Left 987351872 5:17029548-17029570 CCCATTAAAAAGTGGGCAAATGG 0: 13
1: 204
2: 2132
3: 10666
4: 13871
Right 987351877 5:17029561-17029583 GGGCAAATGGCCGGGTGCGCTGG No data
987351872_987351879 17 Left 987351872 5:17029548-17029570 CCCATTAAAAAGTGGGCAAATGG 0: 13
1: 204
2: 2132
3: 10666
4: 13871
Right 987351879 5:17029588-17029610 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
987351872_987351880 18 Left 987351872 5:17029548-17029570 CCCATTAAAAAGTGGGCAAATGG 0: 13
1: 204
2: 2132
3: 10666
4: 13871
Right 987351880 5:17029589-17029611 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
987351872_987351886 30 Left 987351872 5:17029548-17029570 CCCATTAAAAAGTGGGCAAATGG 0: 13
1: 204
2: 2132
3: 10666
4: 13871
Right 987351886 5:17029601-17029623 AGCACTTTGGGAGGCCAAGGCGG 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
987351872_987351884 27 Left 987351872 5:17029548-17029570 CCCATTAAAAAGTGGGCAAATGG 0: 13
1: 204
2: 2132
3: 10666
4: 13871
Right 987351884 5:17029598-17029620 CCCAGCACTTTGGGAGGCCAAGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
987351872_987351882 21 Left 987351872 5:17029548-17029570 CCCATTAAAAAGTGGGCAAATGG 0: 13
1: 204
2: 2132
3: 10666
4: 13871
Right 987351882 5:17029592-17029614 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987351872 Original CRISPR CCATTTGCCCACTTTTTAAT GGG (reversed) Intergenic
Too many off-targets to display for this crispr