ID: 987351875

View in Genome Browser
Species Human (GRCh38)
Location 5:17029552-17029574
Sequence TTAAAAAGTGGGCAAATGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987351868_987351875 -10 Left 987351868 5:17029539-17029561 CCCAACAATCCCATTAAAAAGTG 0: 15
1: 168
2: 469
3: 582
4: 1014
Right 987351875 5:17029552-17029574 TTAAAAAGTGGGCAAATGGCCGG No data
987351866_987351875 -8 Left 987351866 5:17029537-17029559 CCCCCAACAATCCCATTAAAAAG No data
Right 987351875 5:17029552-17029574 TTAAAAAGTGGGCAAATGGCCGG No data
987351867_987351875 -9 Left 987351867 5:17029538-17029560 CCCCAACAATCCCATTAAAAAGT No data
Right 987351875 5:17029552-17029574 TTAAAAAGTGGGCAAATGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987351875 Original CRISPR TTAAAAAGTGGGCAAATGGC CGG Intergenic
No off target data available for this crispr