ID: 987351876

View in Genome Browser
Species Human (GRCh38)
Location 5:17029553-17029575
Sequence TAAAAAGTGGGCAAATGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1213
Summary {0: 7, 1: 22, 2: 76, 3: 253, 4: 855}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987351868_987351876 -9 Left 987351868 5:17029539-17029561 CCCAACAATCCCATTAAAAAGTG 0: 15
1: 168
2: 469
3: 582
4: 1014
Right 987351876 5:17029553-17029575 TAAAAAGTGGGCAAATGGCCGGG 0: 7
1: 22
2: 76
3: 253
4: 855
987351866_987351876 -7 Left 987351866 5:17029537-17029559 CCCCCAACAATCCCATTAAAAAG No data
Right 987351876 5:17029553-17029575 TAAAAAGTGGGCAAATGGCCGGG 0: 7
1: 22
2: 76
3: 253
4: 855
987351867_987351876 -8 Left 987351867 5:17029538-17029560 CCCCAACAATCCCATTAAAAAGT No data
Right 987351876 5:17029553-17029575 TAAAAAGTGGGCAAATGGCCGGG 0: 7
1: 22
2: 76
3: 253
4: 855
987351869_987351876 -10 Left 987351869 5:17029540-17029562 CCAACAATCCCATTAAAAAGTGG 0: 2
1: 31
2: 102
3: 146
4: 370
Right 987351876 5:17029553-17029575 TAAAAAGTGGGCAAATGGCCGGG 0: 7
1: 22
2: 76
3: 253
4: 855

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987351876 Original CRISPR TAAAAAGTGGGCAAATGGCC GGG Intergenic
901377622 1:8850768-8850790 TCAAAAATGGGCAAAGGGCTGGG + Intergenic
901844951 1:11975919-11975941 TAAAAAGAGGGCTCTTGGCCGGG - Intergenic
902188592 1:14744159-14744181 AATAATGTGTGCAAATGGCCAGG - Intronic
902196456 1:14802108-14802130 TCAAAATTGGGACAATGGCCGGG + Intronic
902424022 1:16305087-16305109 TAAAAAGTCAGATAATGGCCAGG + Intronic
903025281 1:20425379-20425401 TTAAAAATGGGCAAAGGACCTGG + Intergenic
903039206 1:20515867-20515889 TTAAAAGTGGATAAATGGCCGGG + Intergenic
903119095 1:21202818-21202840 TAAAAATTAGCCAAGTGGCCAGG - Intergenic
903150833 1:21407214-21407236 TAAAAAATGGACAAAAGGCTGGG - Intergenic
903424217 1:23241305-23241327 AGAAAAATGGGCAAATGCCCGGG + Intergenic
903470379 1:23582698-23582720 TAAAAAGTGGGGCTGTGGCCGGG - Intronic
903476590 1:23623545-23623567 AGAAAAGTGGGCAAAAGGACCGG - Intronic
903525534 1:23991051-23991073 CAAAAAGTGGGCTAAGGGCCAGG - Intergenic
903752050 1:25629714-25629736 TAAAAAGTGGGCAAATGGCTGGG - Intronic
903820810 1:26101089-26101111 TAAAAAGCGTGCAAGGGGCCGGG + Intergenic
903950329 1:26992943-26992965 TAAAGAGGGGGAAACTGGCCGGG - Intergenic
904144875 1:28382061-28382083 TAAAGAGTAGGCAAAGGGCTGGG - Intronic
904850048 1:33452131-33452153 TAAAACATGGGCAAATGGTTTGG + Intergenic
905527635 1:38651106-38651128 TAAAAATTGTGCTAAAGGCCGGG - Intergenic
905534636 1:38711105-38711127 TAAAAAGTGGGTAAAAAGCCTGG + Intergenic
905714607 1:40137736-40137758 TAAAAATTGGGCAAATAAGCTGG + Intergenic
905757775 1:40525979-40526001 TTAAAAGTGGGAAAATGATCTGG + Intergenic
905942838 1:41877751-41877773 TAAAAGGTGGGGAAATGGGTGGG + Intronic
906007177 1:42485495-42485517 TTAAAAATGGGCAAAAGGGCTGG + Intronic
906094688 1:43214179-43214201 TAAAAAGTGGGCTAAGGGGCGGG - Intronic
907017371 1:51030180-51030202 TAAAAAATGGGCAAAGGGCAAGG - Intergenic
907105198 1:51876891-51876913 TAAAAAATCGGCAAACGGGCTGG + Intronic
907131010 1:52096991-52097013 TAAAAAGTGGTCAAAAAGGCAGG + Intergenic
907163731 1:52391601-52391623 CAAAAAGTGGGCAAAGAGCTGGG + Intronic
907221290 1:52908636-52908658 TCAGAAATGGGCAAAGGGCCAGG + Intronic
907374679 1:54026188-54026210 TAAAAAGTAGGCAATGGGCCGGG - Intergenic
907382751 1:54104835-54104857 TAAATATTGGGCAAGGGGCCAGG - Intronic
907590355 1:55660977-55660999 TAAACAGTGGGCAAAGGGCCGGG - Intergenic
907591482 1:55676451-55676473 TAAAAAGTGGGCAAAGGGCCAGG - Intergenic
909016105 1:70381665-70381687 AAAAAACTAAGCAAATGGCCAGG + Intronic
909495183 1:76270209-76270231 TGAAAAGTTGGCAACTGGCCAGG + Intronic
909524268 1:76605567-76605589 TAAAAAGTGAGCAAAGGGCTGGG + Intronic
909603378 1:77483867-77483889 TAAAAGTTTTGCAAATGGCCAGG + Intronic
910084025 1:83376960-83376982 TGATAAGTGGGCAAATGGTATGG + Intergenic
910137423 1:83989001-83989023 TAAAAGGTGGGCAAAAGGCCAGG - Intronic
910307980 1:85788384-85788406 TAAAAAGTGGGCAAAGGGCCAGG - Intronic
910444503 1:87286548-87286570 TTAAAAGTGGAGAATTGGCCGGG + Intergenic
910803434 1:91167180-91167202 TTAAAAATGGTCAAGTGGCCAGG - Intergenic
911167663 1:94738741-94738763 TAAAAAATGGGCAAAGGACATGG - Intergenic
911214397 1:95176484-95176506 TTAAAAATGGGCAAAGGGCTTGG - Intronic
911258667 1:95661849-95661871 TTAAAAATGGGCAAAGGGTCGGG - Intergenic
911269733 1:95786427-95786449 TAAAAAGTTGCAAGATGGCCGGG - Intergenic
911492085 1:98582539-98582561 TCAGAAGTGGGCAAAAGGCCAGG - Intergenic
911493975 1:98607802-98607824 TAAAAAGTGAGAAAAAAGCCAGG + Intergenic
911554056 1:99321291-99321313 TAAAAAATGGACAAAGAGCCGGG + Intergenic
911576268 1:99582263-99582285 TAAAAAGTGAGCAAAAGGCTGGG + Intergenic
911620571 1:100063341-100063363 AAAAAGGTGGGGAAGTGGCCAGG + Intronic
912328987 1:108799568-108799590 TAACAAGTGGGCACATGGATTGG - Intronic
912398366 1:109366934-109366956 TAAAAAGTGTGCTAAGGGCCGGG + Intronic
912847030 1:113083639-113083661 TTAAAAGTGTGCAGCTGGCCGGG - Intronic
912925326 1:113907767-113907789 TAAAGAGTGGGAAATCGGCCAGG - Intronic
913663604 1:121027549-121027571 TAAAAAATGGGCAAAGGACATGG + Intergenic
914015002 1:143810831-143810853 TAAAAAATGGGCAAAGGACATGG + Intergenic
914162820 1:145150394-145150416 TAAAAAATGGGCAAAGGACATGG - Intergenic
914653620 1:149719370-149719392 TAAAAAATGGGCAAAGGACATGG + Intergenic
914708094 1:150187974-150187996 TAAAAAATGTCCCAATGGCCAGG - Intergenic
914842073 1:151256732-151256754 AAAAAAGTGGGCAAAGGAGCCGG - Intronic
914862191 1:151396174-151396196 TAAAAAGTGGAGTAGTGGCCCGG + Intergenic
914906622 1:151751439-151751461 TTAAAAATGGGCAACGGGCCAGG - Intergenic
915338822 1:155165156-155165178 TAAAAAATGGGCAAAGGGGCTGG - Intergenic
915692782 1:157706639-157706661 TAAAAAGTGGGTAAAGGACATGG + Intergenic
915740444 1:158114799-158114821 TAAAAAGGGGGCCAAGGGCCGGG + Intergenic
915803980 1:158825142-158825164 TAAAAAGTGAGCAAAGGGCCAGG + Intergenic
915820857 1:159022257-159022279 CAAAAAGTGGGCTAAGGGCCGGG - Intronic
916419500 1:164623106-164623128 AAAAAAGATGGCAACTGGCCAGG - Intronic
916906030 1:169284408-169284430 TAAAAAGTGGTCAAAGGACATGG - Intronic
916985450 1:170186347-170186369 TAAAAAGTGGGCAAAGGACATGG - Intergenic
917149033 1:171925194-171925216 AAAAAAGTGGGCAAAGGGCCGGG - Intronic
917253617 1:173090016-173090038 TAAAAAGTGGGCAAAGGACATGG - Intergenic
917306389 1:173628999-173629021 TAAGATGTGGGAAAATGCCCTGG - Intronic
917820207 1:178755093-178755115 TAAAAACTGGTGAACTGGCCGGG - Intronic
917857526 1:179113207-179113229 TAGAAAGTGGGTTAATGGCCAGG - Intronic
917876998 1:179294826-179294848 TAAAAAGTGACCAACAGGCCAGG - Intronic
918274994 1:182945257-182945279 TAGAAAATGAGCAAATGGCTGGG - Intronic
918493844 1:185111991-185112013 TAAAAAATGGGCAAAGGACTTGG + Intergenic
918926748 1:190796314-190796336 TAAAAAGTGGGCAAAGGACATGG + Intergenic
918943656 1:191032514-191032536 CAAAAAGTGGGCAAAGGGTAAGG + Intergenic
919154680 1:193748649-193748671 TAAAAAGTGGGCAAAGGACATGG - Intergenic
919428195 1:197460172-197460194 TAAAAATTGAGCAAATTCCCTGG + Intronic
919782114 1:201227724-201227746 TTAAAAGTGGGCAAATCTGCCGG - Intronic
919844818 1:201635339-201635361 TAAAAAATTGGCAAATGGGTTGG - Intronic
920522564 1:206639172-206639194 TTGAAAGTGGGGAAAGGGCCGGG - Intronic
920709855 1:208285073-208285095 TAAAAGGTGGTGAAATGTCCTGG + Intergenic
920751162 1:208678682-208678704 TAAAAAGGGGGAAGCTGGCCGGG + Intergenic
921044894 1:211468765-211468787 CATGGAGTGGGCAAATGGCCGGG + Intergenic
921057900 1:211558023-211558045 TAAAAAATGGGCAAAGGGCCAGG + Intergenic
921197008 1:212767745-212767767 CAAAAAGTGGGCAAAGGACATGG + Intronic
921281292 1:213570665-213570687 TAAAAAGTGGACAACTGCCCTGG - Intergenic
921455134 1:215362081-215362103 TAAATAATGGGCAAAGGACCTGG - Intergenic
921471110 1:215551133-215551155 TAAAAAGTGGGCAAAGGACATGG - Intergenic
921581179 1:216898320-216898342 TAAGAAGTTGGTACATGGCCAGG + Intronic
922227822 1:223660868-223660890 TTAAAAATGGGCAAAGGGGCTGG + Intronic
922379539 1:225008718-225008740 TAAAAAGTCAGGAAACGGCCAGG - Intronic
922475118 1:225901609-225901631 TAAGAAATGGGCAAAAGACCTGG + Intronic
922856091 1:228775837-228775859 TAAAAAGTTGCCATAGGGCCCGG + Intergenic
923206886 1:231767827-231767849 TAAGAAGTGGCAAATTGGCCTGG - Intronic
923618922 1:235561303-235561325 TAAAAAATGGGCAAAATGGCCGG - Intronic
924085637 1:240448845-240448867 TAAAAAGTGGTTAACTGGCAGGG + Intronic
924190596 1:241548133-241548155 TAAAAAATGGGTAAATGGCGGGG + Intronic
924951014 1:248883415-248883437 TTAAAAATGGGCAAAGGACCGGG - Intergenic
1062864356 10:838440-838462 TAAAAAATGGGCAGAAGACCTGG + Intronic
1063857443 10:10271318-10271340 GAAACAGTGGGCAAATGGGAAGG - Intergenic
1063968500 10:11364958-11364980 TAAAAAGTGGGGACATCTCCAGG - Intergenic
1064476156 10:15691014-15691036 TAAAAATTAGTCAAAGGGCCTGG + Intronic
1065016115 10:21464368-21464390 TAAAGAGTGGACAGAAGGCCGGG + Intergenic
1065095965 10:22280988-22281010 CAAAAAGAAGGAAAATGGCCAGG - Intergenic
1065157413 10:22884783-22884805 TAAAAAGTGGGCAAAGGATATGG + Intergenic
1065223474 10:23519604-23519626 TAAAAAATGGGCAAAGGACATGG - Intergenic
1065275113 10:24078008-24078030 TAAAAAGTAGGCAAAGGACATGG - Intronic
1065843975 10:29729538-29729560 TTAAAAGTTGGCAATTGGCCGGG + Intronic
1065865136 10:29908481-29908503 TAAAAAGTTTGCAGAGGGCCTGG - Intergenic
1066112398 10:32208833-32208855 TAAAAAGTCAGGAAATGGCCAGG - Intergenic
1066273788 10:33848496-33848518 TAAAAAGTCAGGAAATGGCTGGG - Intergenic
1066398095 10:35046594-35046616 TAAAAACTGGGTTATTGGCCAGG + Intronic
1066421022 10:35264922-35264944 TAAAAACTGGGCAAAAGGCCGGG - Intronic
1066423211 10:35280922-35280944 TAAAAAATGGGCAAAGGATCTGG + Intronic
1066468938 10:35679302-35679324 TAAAAAGTCAGGAAACGGCCGGG + Intergenic
1067129739 10:43552176-43552198 TCAAAACTGGACAAAAGGCCAGG - Intergenic
1067138639 10:43634904-43634926 TAAAAAGTGGGCAAACAGATGGG - Intergenic
1067182975 10:44004602-44004624 GAAAAATTGGGAAAATGCCCTGG + Intergenic
1067929775 10:50548872-50548894 TAAAAAGTGGGTAAAGGACATGG + Intronic
1067959408 10:50831431-50831453 TTAAAAATGGGCAAAAGGCCGGG + Intronic
1068162034 10:53277206-53277228 CAAAAAGTGGGCAAAGGACATGG + Intergenic
1068334261 10:55611335-55611357 AAAAAAATGGGCAAAAGACCTGG + Intronic
1068406212 10:56592886-56592908 CAAAAAGTGGGCAAAGGACATGG - Intergenic
1068750001 10:60581732-60581754 TAAAAAATGGGCAAAATGGCCGG - Intronic
1068841924 10:61625089-61625111 TGACAAGTGGGCAAATGTCTAGG - Intergenic
1069012721 10:63392529-63392551 TAAAAAGTGGGCAAAAGGCCGGG + Intronic
1069199800 10:65598922-65598944 TAAAAAGTGGGCCAAAAGGCTGG - Intergenic
1069239939 10:66126971-66126993 AGAAAAGGGGGAAAATGGCCGGG + Intronic
1069341586 10:67416310-67416332 TAAAAAGTGGACAAATGACCAGG + Intronic
1069811702 10:71165315-71165337 TAAAAAGTGGGCAAAGGGCTGGG + Intergenic
1069922765 10:71827099-71827121 CAAAAATGGGGTAAATGGCCGGG + Intronic
1069969536 10:72154291-72154313 TAAAACTTGGGCAAAAGGCTGGG + Intronic
1070013857 10:72504802-72504824 TTAAAAGTGGGCAAAGGACATGG + Intronic
1070229761 10:74552754-74552776 TAAAAATTGGGCAAAAGACTTGG + Intronic
1071537201 10:86443724-86443746 TTAAAACTGGGCAAAGGGCCAGG + Intronic
1071542160 10:86495817-86495839 TCAAAAATGGGCAAAGGGCCGGG + Intronic
1072144800 10:92625334-92625356 AAAAAAGTGGGCAAATGATGTGG - Intronic
1072254313 10:93606451-93606473 TAAAAAGTGGGCAAAGGACAGGG + Intergenic
1072663073 10:97374455-97374477 TACAAAGTGGGCATGTGGCTGGG - Intronic
1072902241 10:99418796-99418818 TTGAAAGTGGGGAACTGGCCAGG - Intronic
1073283210 10:102369835-102369857 TAGAAAAAGGGCACATGGCCTGG - Intronic
1073964745 10:108976542-108976564 CAAAAAGTGGGAAAATTGGCTGG + Intergenic
1074301290 10:112235289-112235311 TAAAAAGTGGGCAGTTGGGAAGG + Intergenic
1074461915 10:113646135-113646157 TAAAAAGTGTGAAAAGGGCCAGG - Intronic
1074588440 10:114789741-114789763 TAAAAAGTGGGCATAGGACATGG - Intergenic
1074685071 10:115954455-115954477 AAATAAGTGGGGAAACGGCCTGG + Intergenic
1074822386 10:117190498-117190520 TTAAAAATGGGCAAAAGGCTGGG + Intergenic
1075000090 10:118790276-118790298 CAAAAAGTGGGCAAAGGACATGG + Intergenic
1075008591 10:118848941-118848963 CAGAAATTGGGCAAAGGGCCTGG + Intergenic
1075057607 10:119231242-119231264 TAAAAAATGGGCAGATGATCTGG + Intronic
1075156745 10:119983837-119983859 TAAAAAATGGCCAAAAAGCCAGG - Intergenic
1075211201 10:120492730-120492752 TTAAAAGTGGGGAAATAGCAAGG - Intronic
1075241115 10:120779937-120779959 TCAAAAGTGGGTTATTGGCCGGG - Intergenic
1075816505 10:125268736-125268758 TAAAAAGTGGGCAAAAGGACGGG - Intergenic
1075956959 10:126532540-126532562 TAAAGAGTGAGCACATGGCCGGG + Intronic
1076609833 10:131717191-131717213 TAAAAAGTGGGCAAAAGGCCAGG + Intergenic
1077422052 11:2456623-2456645 TAAAAAGTGGGCAAAAGGGCCGG + Intronic
1077440245 11:2565437-2565459 TAAAAAATAGGCAAAGGGCTTGG - Intronic
1077450634 11:2641453-2641475 TAAAAAGTGAGCAAAAGACATGG - Intronic
1077526010 11:3065486-3065508 TAAAAAGTGGGCAAAAGGCCAGG - Intergenic
1078016906 11:7622986-7623008 TAAAATGTGTGCAAATAGCTTGG - Intronic
1078086918 11:8239435-8239457 TAAAAAGAGGGCACAGGGCTGGG + Intronic
1078173152 11:8945373-8945395 TTAAAAATGGGCAAAAGTCCTGG - Intergenic
1078502113 11:11890368-11890390 TAAAAAGTAGGCAAAGGGCATGG + Intronic
1078997859 11:16722355-16722377 TAAAAAGTGGGCAATGGGCCGGG + Intronic
1079043847 11:17082428-17082450 AATAAAATGGGCAAAGGGCCAGG - Intronic
1079043898 11:17082852-17082874 TTAAAAATGGGCAAAGGGCCGGG - Intronic
1079710344 11:23675656-23675678 TAAAAAGTGGGCCAAGGACGTGG + Intergenic
1079921739 11:26441410-26441432 TAAAAACTGGGCAGCAGGCCGGG - Intronic
1080023487 11:27589113-27589135 GAAAAAGTGGGCAAAAGACATGG - Intergenic
1080470497 11:32540332-32540354 TAAAAAGTGGGCAACTGGCTGGG - Intergenic
1081096456 11:38942241-38942263 CAAAAAGTGGGCAAAGGACATGG - Intergenic
1081107136 11:39084403-39084425 TAAAAAATGGGCAAAGGACATGG - Intergenic
1081376550 11:42366269-42366291 TAAAAAATGGGCAAAGGACCTGG - Intergenic
1082702862 11:56454756-56454778 TAAAAAGTGGTCAAAAGACATGG - Intergenic
1083356273 11:62068659-62068681 TAAAAACTGCACAAAAGGCCAGG - Intergenic
1083798335 11:65031612-65031634 TAAAAATTGGGCTGATGGCCGGG + Intronic
1084555429 11:69872896-69872918 TAAAAAATGGGCAAAAAGCCTGG - Intergenic
1084620199 11:70264706-70264728 TAAAAATTGGTCCATTGGCCAGG - Intergenic
1084620784 11:70269126-70269148 TTAAAAGTGTAAAAATGGCCAGG - Intergenic
1084749522 11:71195095-71195117 TAAAAAGTGCCTAACTGGCCAGG + Intronic
1084851576 11:71945815-71945837 TAAAAAATGGGCAAAAGGCCAGG + Intronic
1084958630 11:72704436-72704458 GGGAAAGTGGGCAGATGGCCTGG - Intronic
1085078269 11:73611253-73611275 AAAAAAATGGGCAAGTGGCCAGG - Intergenic
1085115978 11:73932128-73932150 TAAAAAGTTGACAACTGGGCTGG - Intergenic
1085679067 11:78553582-78553604 TAAAAAGTGGGCAAATGGCTAGG - Intronic
1086357639 11:86021051-86021073 TTAAAAATGAGCAAAAGGCCAGG + Intronic
1086376681 11:86207888-86207910 TTAAAAATGGGCAAAGGGTCGGG + Intergenic
1086830293 11:91553653-91553675 AAAAAACTGGGCATATGGCAGGG - Intergenic
1086977818 11:93156676-93156698 TAAAAAGTGGGCAAAGGGCTTGG - Intronic
1087378320 11:97371675-97371697 TAAAAAGTGGGCAAAGAACATGG + Intergenic
1087431657 11:98064009-98064031 TAAAAAGCAGGTAACTGGCCGGG + Intergenic
1087444830 11:98237977-98237999 TAAAAACTGGGCAAAGGGCTGGG + Intergenic
1087520695 11:99231465-99231487 TAAAAAGTGGGCAAAGGACACGG - Intronic
1087731508 11:101783462-101783484 TAAAAAGTAGGCAAAGGACATGG - Intronic
1088275411 11:108080383-108080405 AAAAAAATGGGCAAAAGGCCTGG - Intronic
1088291755 11:108246117-108246139 TAAAAAGTGGCTACACGGCCGGG - Intronic
1088496817 11:110439500-110439522 TAAAAAGTGGGCAGAGGGCCGGG - Intronic
1088552967 11:111033118-111033140 TAAAAAGTGGCCAAAGGACATGG + Intergenic
1089058550 11:115607547-115607569 AATAAGGTGGGCAAAGGGCCAGG + Intergenic
1089476608 11:118768712-118768734 TAAAAATTGGAAAAATGGCCAGG + Intronic
1089763055 11:120742358-120742380 AAAAAAGTGGGCAAAGGACATGG + Intronic
1089811182 11:121133025-121133047 TAAAAAATGGAAAACTGGCCGGG - Intronic
1089983369 11:122790649-122790671 TTAAAAGTGGGTGTATGGCCAGG + Intronic
1090180064 11:124689489-124689511 TAAAAAGTGGGCAAAGGGCTGGG + Intronic
1090391167 11:126388625-126388647 TTAAAAATAGGCAAAGGGCCAGG - Intronic
1090522135 11:127490532-127490554 TCCACAGTGGGTAAATGGCCCGG - Intergenic
1090756020 11:129792665-129792687 TCAAGATTGGGCAAAGGGCCTGG + Intergenic
1091895550 12:4101007-4101029 TAAAAAGTGGGCAAGCGGCCAGG + Intergenic
1092107990 12:5937376-5937398 TAAAAAATAGGCAAATGACCTGG - Intronic
1092439736 12:8489307-8489329 TAAAAAATGGAGAAAGGGCCAGG + Intergenic
1092532452 12:9355752-9355774 TAAAAAGTCAGGAAACGGCCAGG - Intergenic
1092564726 12:9651915-9651937 TAAAAAGTGGGCCAATGATTTGG - Intergenic
1092620102 12:10254591-10254613 TAAAAAGTAGGCAAAAGGCTGGG + Intergenic
1092740601 12:11625577-11625599 TAAAAAGTGGGCAAAAGATCTGG + Intergenic
1093010985 12:14106730-14106752 CATAAAGTGGGAAAAGGGCCAGG + Intergenic
1093150276 12:15612413-15612435 TCAAAAGTAGGCAAAGGGCCAGG - Intergenic
1093899546 12:24615219-24615241 TAAAAAATAGGCAAATGAACTGG + Intergenic
1094128879 12:27053424-27053446 TAAAAAGTGGGTAAAGGACATGG - Intronic
1094542405 12:31373322-31373344 CAAAAAAAGGGCAAATGGCCGGG - Intergenic
1094672135 12:32580590-32580612 TAAAATCTGTACAAATGGCCGGG + Intronic
1094710096 12:32953887-32953909 TAAAAAATGTGAAAATGGGCTGG + Intergenic
1095281628 12:40358061-40358083 TTAAAAGTAGGCAAAGGGCTGGG - Intronic
1095353109 12:41238549-41238571 TAAAAAGTGGGCAAAGAACATGG + Intronic
1095542559 12:43327916-43327938 TAAAAAGTGGGCAAAAGACATGG - Intergenic
1096031089 12:48415759-48415781 TAGAAAATGGTCAAATGGTCAGG - Intergenic
1096043137 12:48538217-48538239 TTAAAAGTGGGCAAATGGCCAGG + Intergenic
1096708484 12:53438322-53438344 AAAAAAGTGGGCAAAAGGCCAGG + Intergenic
1096719473 12:53510332-53510354 TAAGAAGTGGTAAACTGGCCGGG - Intronic
1096830140 12:54307389-54307411 AAAGAAGTTGGTAAATGGCCAGG - Intronic
1097029765 12:56082003-56082025 CAAACAGGGGGCAAAGGGCCTGG - Intronic
1097133263 12:56829861-56829883 TAAAAATTGGGCAAAGGGGCTGG + Intergenic
1097773721 12:63621250-63621272 TATAAACTGAGCAAATTGCCAGG + Exonic
1099727297 12:86448220-86448242 TAAAAAGTGTACAAATGATCAGG - Intronic
1100428789 12:94511909-94511931 TAAACAATGTGCAAATGACCTGG - Intergenic
1100662270 12:96712861-96712883 TAAAAAGTAGGCAAAAGACCTGG + Intronic
1101007539 12:100415723-100415745 TAAAAAGTGGCAAGAAGGCCAGG - Intronic
1101117228 12:101543697-101543719 AAAAAAAAAGGCAAATGGCCAGG - Intergenic
1101119134 12:101561150-101561172 CAAAAAGTGGGCAAAGGACATGG - Intergenic
1101163183 12:102000193-102000215 TAAAAAATGGGCAAAGGGCCAGG - Intronic
1101332428 12:103768137-103768159 TAAAAAGTTTGAAAATGGCCAGG + Intergenic
1101388840 12:104281699-104281721 TTAAAAGTGGAGATATGGCCGGG - Intronic
1101397154 12:104358443-104358465 TAAAAAGTGGGTGTAGGGCCGGG - Intergenic
1101614331 12:106321385-106321407 TAAAATGTGGGCAAAGAGCTTGG + Intronic
1101858002 12:108460322-108460344 TAAAAAGGGGGAAAATGGGTCGG + Intergenic
1101984826 12:109437790-109437812 TAAAAATTGGGAAACAGGCCAGG + Intronic
1102246243 12:111357999-111358021 TTAAAATTGGGCAAAAGGCCGGG - Intergenic
1102537988 12:113595959-113595981 TAAAAAGTGGTCAAAGGGCTGGG - Intergenic
1102859861 12:116326419-116326441 TTAAAAGAGGGCTTATGGCCGGG - Intergenic
1102899568 12:116625861-116625883 TAAAAACAGGGAAAATGGCCAGG - Intergenic
1103108788 12:118255785-118255807 TAAAGAATGGACATATGGCCGGG + Intronic
1103646937 12:122401380-122401402 TAAAAAGTAGGTCAATGGGCCGG + Intronic
1103891817 12:124244897-124244919 TCAAAAATGGGCAAAAGGGCTGG - Intronic
1104470993 12:129029460-129029482 AAAAAAGTGGGCTCATGGCCAGG + Intergenic
1104497973 12:129258580-129258602 TAAAAAGTGAACACATGGCCTGG - Intronic
1105042267 12:132969792-132969814 TAAAAAGCAGGCAGAGGGCCAGG + Intergenic
1105205833 13:18222917-18222939 TAAAAACTGAGCATATGGCCAGG + Intergenic
1105233246 13:18520686-18520708 CAAAAAGTGGGCAAAGGACATGG + Intergenic
1105299492 13:19119213-19119235 TAAAAAGTGGGTAGATGGAGTGG + Intergenic
1105375526 13:19840971-19840993 TAAAAAGTGGCCAGGTGGGCCGG - Intronic
1105380083 13:19878806-19878828 TCAAAAATGGGCAAAGGGCTGGG - Intergenic
1105655297 13:22430085-22430107 TAAAAAGCGGGCAAAGGACATGG - Intergenic
1105735444 13:23265280-23265302 TAAAAAGTAGGCAAAGGGGCCGG + Intronic
1105947550 13:25202674-25202696 TGAAAAGTGGGAAACAGGCCCGG + Intergenic
1106461563 13:29974752-29974774 TAAAAATTGGTCAAATGGGTTGG + Intergenic
1106805876 13:33306652-33306674 TAAAAAGTGAGCAAAGGACTGGG + Intronic
1107512342 13:41096984-41097006 TAAAAAGTGGACAAACGGCCAGG - Intergenic
1107829496 13:44361913-44361935 TAAAGAATTGGCAGATGGCCAGG + Intergenic
1108634343 13:52317600-52317622 TAAAAGATGGACACATGGCCAGG - Intergenic
1108635549 13:52331226-52331248 TTAAAAGTGGGAAAAGGGTCAGG + Intergenic
1108652256 13:52492015-52492037 TTAAAAGTGGGAAAAGGGTCAGG - Intergenic
1108765973 13:53629942-53629964 TAAAAAGTATGCAAAGGGCTGGG - Intergenic
1109127592 13:58537066-58537088 TAAAAAATGGGCAAAGGACATGG - Intergenic
1110460766 13:75743042-75743064 AAAAAAGTGGGCAAAGGACATGG + Intronic
1110570505 13:76997439-76997461 CAAAAAGTGGGTTAACGGCCGGG - Intronic
1110802372 13:79713969-79713991 TTAAAAATGGGCAAAGAGCCAGG + Intergenic
1111087940 13:83400981-83401003 TAAAAAGTCAGGAAATGGCCAGG - Intergenic
1111192365 13:84825970-84825992 TAAAAAGTGGGCAAAAGGCCGGG - Intergenic
1111359915 13:87162849-87162871 TAAAAAGTCAGGAACTGGCCAGG + Intergenic
1111673789 13:91361825-91361847 TTAAAAGTGGGCAAAGGTCATGG - Intergenic
1111744392 13:92248310-92248332 TTATATGTGGGCAAATTGCCAGG - Intronic
1112055467 13:95686254-95686276 TAAAAAGTGGGCAAAGGGCCAGG - Intronic
1112138075 13:96605899-96605921 TAAAAAATGGGCAAAGGACAGGG + Intronic
1112143000 13:96666942-96666964 TAAAAAATGGGCAAATTTACTGG - Intronic
1112192250 13:97189187-97189209 TAAGAAGTGTGGAGATGGCCAGG - Intergenic
1112345551 13:98586152-98586174 TAAAAACTGGGACCATGGCCAGG - Intergenic
1112398232 13:99052812-99052834 TAAAAAATGGGCAAAGAGCCTGG - Intronic
1112682545 13:101783491-101783513 TAAAAAGTGGGCAAAGGATATGG - Intronic
1112735183 13:102408202-102408224 TAAAAAGTAAAAAAATGGCCGGG - Intergenic
1112904383 13:104398963-104398985 TAAAAAATGGGCAAAAGGCCAGG - Intergenic
1113470709 13:110543426-110543448 TAAACAATGAGCAAAGGGCCAGG - Intronic
1114400816 14:22408813-22408835 TAAAAAGTGAGAATATGGCAAGG - Intergenic
1114586692 14:23821226-23821248 TAAAAACTGGGCAAAGGACATGG - Intergenic
1114626632 14:24134589-24134611 TAAAAAATGTAAAAATGGCCGGG - Intergenic
1114643618 14:24241332-24241354 TCAAAAGTGGGTTAGTGGCCAGG + Intronic
1114782466 14:25553453-25553475 TTAAAAGTGGACAAAAGACCTGG - Intergenic
1115238589 14:31232473-31232495 TTAAAAATGGGCAATTGGCCGGG + Intergenic
1115297030 14:31840276-31840298 TAAAAAGAGAGAAATTGGCCAGG + Intronic
1115325429 14:32132401-32132423 CAAAAAGTGGGCAAAGGACATGG - Intronic
1115760187 14:36572878-36572900 TATAAAATGGGCAAAAGGGCTGG - Intergenic
1115899758 14:38132040-38132062 TTAAAAATGGGCAAAGGACCTGG + Intergenic
1116066634 14:39992583-39992605 TAAAAAGTAGGCAAAGGACATGG - Intergenic
1116268675 14:42730456-42730478 TCATAAGTGGGCAGATGGGCAGG + Intergenic
1116633242 14:47360054-47360076 TAAAAGATGTGCAAAGGGCCGGG + Intronic
1116733877 14:48663320-48663342 TTAAAAATGGGCAAAGGACCTGG + Intergenic
1116834368 14:49755479-49755501 AAAAAAATGGGCAAAAGACCTGG - Intergenic
1117018394 14:51542934-51542956 TAAAAAATGTGCACAGGGCCTGG - Intronic
1117711210 14:58531012-58531034 CAAAAAGCGGGCAAAGGGGCCGG + Intronic
1118027102 14:61780507-61780529 TAAAAAACGGGCAAAGGGCTGGG - Intronic
1118124851 14:62890398-62890420 TAAAAAGTGGGCAAAGGGCCGGG + Intronic
1119259783 14:73231114-73231136 TAAAAAGAGGGCTTCTGGCCAGG + Intergenic
1119999944 14:79291514-79291536 TTTAAAGTGGGAAAATGGGCTGG - Intronic
1120009080 14:79392674-79392696 TAAAAAGTCAGGAAATGGCCAGG + Intronic
1120066578 14:80047947-80047969 GAATTTGTGGGCAAATGGCCAGG + Intergenic
1120151518 14:81040839-81040861 TAAAAAGTGGGCAAAGGACATGG + Intronic
1120152410 14:81051854-81051876 TTAAAAATGGGCAAATGACATGG - Intronic
1120280052 14:82427965-82427987 TAAACTGTGGGCAGATGACCAGG - Intergenic
1121481621 14:94281902-94281924 TTAAAAGTGGGAAATTGGACTGG + Exonic
1122030102 14:98905828-98905850 TTAAAAGTTTGAAAATGGCCGGG - Intergenic
1123763643 15:23452895-23452917 TTATATGTGGGCAAATTGCCAGG - Intergenic
1123814068 15:23958959-23958981 TAAAAAGTGGGCAAAGGACATGG - Intergenic
1123814585 15:23963916-23963938 TAAAAAGTGGGCAAATGAACAGG - Intergenic
1123857693 15:24430549-24430571 TAAAAAGTAGGCAAAGCACCGGG - Intergenic
1123862322 15:24481083-24481105 TAAAAAGTAGGCAAAGCACCGGG - Intergenic
1123894523 15:24815413-24815435 AAAAAACTGAGCAAAGGGCCAGG - Intergenic
1123900499 15:24871998-24872020 TAAAAAGAGGACAAAAGGCCGGG - Intronic
1124875534 15:33589273-33589295 TAAAAAGTGAGCAAAGGACATGG - Intronic
1124970229 15:34482395-34482417 TAAAATGTGGGAATATTGCCTGG - Intergenic
1125255194 15:37755367-37755389 TAAAAAGTGGGTAAACAGCTGGG + Intergenic
1125839482 15:42785414-42785436 TAAAAAGTCTGCAAGTGGCCGGG - Intronic
1126019446 15:44385852-44385874 ATAAAAATGGGCAAAGGGCCAGG - Intronic
1126496553 15:49297246-49297268 TAAAAAATGGGCAAAGGACATGG - Intronic
1126609923 15:50518989-50519011 TAAAAAGTGGGCAAAGGGCCAGG + Intronic
1126743718 15:51803788-51803810 AGAAAAATGGGCAAATGGCATGG + Intronic
1126877058 15:53054937-53054959 TAAAAAGTGGGCAAAGGCCATGG + Intergenic
1127085355 15:55419531-55419553 TTAAAAGTGGGAAATTGGCTGGG - Intronic
1127243739 15:57148584-57148606 CAAAAAATGCTCAAATGGCCAGG + Intronic
1127714492 15:61636111-61636133 TCAAAAGTGGACAAATGACATGG + Intergenic
1128011328 15:64299291-64299313 TAAAAAGTATATAAATGGCCGGG + Intronic
1128051105 15:64665611-64665633 TAAAAAGTAAACAAATGGGCCGG + Intronic
1128058732 15:64719863-64719885 TCAAAAGTGGGGATATGGCCAGG + Intergenic
1128375467 15:67071512-67071534 TAAAAAGTGGACAACTTGGCTGG + Intronic
1128423774 15:67519973-67519995 TAAAAACTGGGGAATAGGCCTGG + Intergenic
1128504383 15:68256402-68256424 TAAAAAAGGGAAAAATGGCCGGG - Intronic
1128636657 15:69306697-69306719 TAAAAAATGGTTAAATGGGCGGG - Intronic
1128771416 15:70285363-70285385 TAAACAGTGGGAAAATGGGGAGG - Intergenic
1128884262 15:71272104-71272126 TTAAAAATGGGCAAAGGGGCTGG + Intronic
1128976622 15:72158880-72158902 TGAAAAATGGGCAAAAGGCTGGG - Intergenic
1129023829 15:72549616-72549638 TAAAAATTGAACAAATGACCTGG - Intronic
1129554910 15:76497695-76497717 TAAGAAGTAAGCACATGGCCGGG + Intronic
1129575455 15:76738646-76738668 TAAGAAATGGGGGAATGGCCAGG + Intronic
1129583464 15:76837213-76837235 TAAAAAATGGGCAAAGGACATGG + Intronic
1130121873 15:81057116-81057138 TAAAAACTGGGCAAACAGCCAGG - Intronic
1130550178 15:84885434-84885456 AAAAAAGTGGAGAAAAGGCCAGG + Intronic
1130573057 15:85066263-85066285 AAAAAAGTAGGCATATGGCCAGG + Intronic
1130801283 15:87266192-87266214 TAAAAAGTAGACAACTGTCCAGG + Intergenic
1131005694 15:88975944-88975966 CAAAAAGTGGGCAAAAAGTCAGG - Intergenic
1131106861 15:89740842-89740864 TAAAAAGTGTTAAATTGGCCGGG + Intronic
1131178067 15:90222272-90222294 TAAAAAATGTGAAAATAGCCGGG + Intronic
1131309985 15:91281577-91281599 TAAGAAGTGGGGAAGTGGTCTGG + Intronic
1131393106 15:92065381-92065403 TCAAATCTGGGTAAATGGCCGGG - Intronic
1131704530 15:94978778-94978800 TTAAAAATGGGCAAATGGGCTGG + Intergenic
1131719894 15:95156521-95156543 TAAAAAGAGAACAACTGGCCGGG + Intergenic
1131740015 15:95378982-95379004 TAAAAAGTGGGCAAAGGACATGG + Intergenic
1131870833 15:96762791-96762813 CAAAATGTTGGCAAATGGCTTGG - Intergenic
1132015972 15:98317204-98317226 TAAAAAGAGGAAAAAAGGCCAGG - Intergenic
1132048708 15:98588969-98588991 TAAAAATTTGGCAATTGGCCAGG + Intergenic
1132127034 15:99236681-99236703 TAAAAAGTGGGAAAAGGGCCAGG - Intronic
1132908046 16:2293832-2293854 TAAAAATTAGCCACATGGCCAGG - Intronic
1132957226 16:2600845-2600867 TAAAAAGTGAACAAATGGCAGGG - Exonic
1132969569 16:2679257-2679279 TAAAAAGTGAACAAATGGCAGGG - Intergenic
1133117384 16:3585288-3585310 TAAAAAATGGGCAAAGGGGCCGG + Intronic
1133252965 16:4496417-4496439 TGAAAAGTGAGCAAGAGGCCAGG - Intronic
1133342784 16:5047675-5047697 TAGAAAGTGGGGAGATAGCCTGG - Intronic
1133419466 16:5633576-5633598 CAAAAAGTGGGTAAAGGGCTGGG + Intergenic
1133813651 16:9180054-9180076 TTAAAAGTGTGCAGCTGGCCGGG - Intergenic
1134143980 16:11745335-11745357 TAAAAAGTGGCCAAGAGGCTGGG - Intergenic
1134488183 16:14675643-14675665 CAAAAAGTGGGCACATGGCCAGG + Intronic
1134524196 16:14931763-14931785 TAAAAAATGGGAACACGGCCAGG - Intronic
1134548709 16:15129171-15129193 TAAAAAATGGGAACACGGCCAGG + Intronic
1134673228 16:16071391-16071413 GAAAAAATGGGCGAATGGCTGGG - Intronic
1134711785 16:16330249-16330271 TAAAAAATGGGAACACGGCCAGG - Intergenic
1134955043 16:18378444-18378466 TAAAAAATGGGAACACGGCCAGG + Intergenic
1136221417 16:28831621-28831643 TAAAAAGTTAGCAACTGGCAGGG - Intronic
1136626673 16:31466034-31466056 CAAAAGGTGGGCAACGGGCCTGG - Intronic
1137261910 16:46837777-46837799 TTAAAAGTTGGCACTTGGCCAGG + Intergenic
1137349769 16:47703344-47703366 TAAAATGGGGGCAAAGGGGCCGG + Intergenic
1137511278 16:49102897-49102919 TACAAAGTGAGCCTATGGCCAGG - Intergenic
1137639634 16:50017250-50017272 TTAAAAATGGACAAAGGGCCGGG - Intergenic
1137659944 16:50196630-50196652 TAAAAAGAGTACAACTGGCCAGG + Intronic
1138380134 16:56594874-56594896 TAAAAATTAGGCAAAAGGCCGGG + Intergenic
1138517751 16:57546419-57546441 ATAAAAATGGGCAAATGGCGGGG - Intronic
1139899776 16:70318807-70318829 AAAAAAGTTGACATATGGCCGGG + Intronic
1139905339 16:70361739-70361761 TAAAAACTGGGCTTAAGGCCGGG + Intronic
1140869611 16:79094545-79094567 TTAAAACTGAGGAAATGGCCTGG - Intronic
1141075221 16:81000200-81000222 TAAAAAGTGGGCAAAAGGCTGGG + Intronic
1141458933 16:84165072-84165094 AAAAAACTGGGCAAATGATCAGG - Intronic
1141808905 16:86360870-86360892 TTAAAAGTGGGTCACTGGCCAGG - Intergenic
1141941893 16:87282372-87282394 TTAAAATGGGGCAAAGGGCCAGG + Intronic
1142016631 16:87752109-87752131 AAAAAAGAAGCCAAATGGCCAGG + Intronic
1142051747 16:87963324-87963346 TAAAAAGTTAGCACAGGGCCTGG - Intronic
1142761495 17:2044626-2044648 TTAAGAGTGGGCAATTGGCCAGG - Intergenic
1143257459 17:5572420-5572442 TAAAAAGTGGACAAATGGCCAGG + Intronic
1143433468 17:6904434-6904456 TAAAAAATGGACAAAAGGCCTGG + Intronic
1143806407 17:9431362-9431384 TAAAAAATGAGCCAAAGGCCAGG - Intronic
1143907490 17:10220919-10220941 TAAAAAATTGGGAAATGACCAGG + Intergenic
1143915470 17:10289275-10289297 TTAAAAGTGTCCAAATGGCCAGG + Intergenic
1143983039 17:10886731-10886753 TAAAAAGTGGGCAAAGGACATGG - Intergenic
1143991738 17:10969692-10969714 TAAAAACTGGGCAAATGACATGG + Intergenic
1144715733 17:17434503-17434525 TAAGAAGTTGGGAAATGGGCAGG + Intergenic
1145190064 17:20832289-20832311 TAAAAAATGGGCAAAAGACCTGG + Intergenic
1145401264 17:22536157-22536179 TAAAAAATGGGCAAAAGACCTGG + Intergenic
1146081082 17:29781104-29781126 TAAAAAGGGAGAAAAAGGCCGGG - Intronic
1146089401 17:29861039-29861061 TTAAAAGTGGGCCAAAGGGCTGG - Intronic
1146091783 17:29886449-29886471 TAAAAGTTTGGAAAATGGCCGGG + Intronic
1146227780 17:31081929-31081951 TAAAAAACAGGCAAATGGCCTGG - Intergenic
1146281491 17:31548036-31548058 TTAAAAATGGGCAAAAGGCTGGG - Intergenic
1146560423 17:33864200-33864222 TAAAAAGAAGGTAACTGGCCAGG - Intronic
1146690674 17:34873449-34873471 TTAAAAATGGGCAAATGGCTGGG - Intergenic
1146995880 17:37320649-37320671 TAAATTGTGGGCAATAGGCCAGG + Intronic
1147408352 17:40230040-40230062 TAAAAAATGGGTAAATAGGCTGG + Intronic
1148499845 17:48081735-48081757 TAAAAAGTAAGGAAAGGGCCAGG - Intronic
1148564636 17:48625722-48625744 TAAAAAGTGAGGAAATACCCAGG - Intronic
1149014877 17:51896901-51896923 TTAAAAGTGGGCAAAGGACATGG - Intronic
1149230958 17:54533378-54533400 TAAAAAGTGGGCAAAGGACATGG - Intergenic
1149362171 17:55907014-55907036 TAAAGAGTGGGCAAAGGACATGG - Intergenic
1149680053 17:58499923-58499945 TTAAAACTGGACAAATGGCTGGG - Intronic
1150048274 17:61934481-61934503 TAAAAAGTGGGCAAAGAGGCCGG + Intergenic
1150313554 17:64149482-64149504 TAAAATGTAAGCTAATGGCCAGG + Intronic
1150577014 17:66439473-66439495 TATAATGTGGGTAAAAGGCCGGG - Intronic
1151098110 17:71522448-71522470 TAAAAAATGGGCAAAGGACATGG + Intergenic
1151240855 17:72756852-72756874 TTAAAAGTGGTGCAATGGCCGGG + Intronic
1151779180 17:76231290-76231312 TAAAAAATGTGCAAGAGGCCGGG - Intronic
1151779371 17:76233213-76233235 TAAAAAATGTGCAAGAGGCCAGG - Intronic
1152322123 17:79613525-79613547 TAAAAAGTGAGCACATGGGGAGG + Intergenic
1153036307 18:765691-765713 TAAAAAGTGTTAAATTGGCCGGG - Intronic
1153202720 18:2662348-2662370 TAACAAGTGGGACATTGGCCAGG + Intronic
1153633349 18:7093119-7093141 TAAAAAGGCGTCAAATGGCGGGG + Intronic
1153635961 18:7113779-7113801 TAAAAAATGGGAAAGAGGCCGGG + Intronic
1153862604 18:9228627-9228649 TAAAAAATGGGCAAAGGACTTGG - Intronic
1154097416 18:11431109-11431131 AAAAAAATGGGCAAAGGGCAGGG - Intergenic
1154250719 18:12742109-12742131 TAAAAAATGGGCATAGGGCAGGG - Intergenic
1154308495 18:13248254-13248276 AAAAAAGTGGGGCTATGGCCGGG - Intronic
1154372883 18:13780841-13780863 TAAAAAGTGGGCAGAGGGGCCGG + Intergenic
1154517680 18:15190827-15190849 CAAAAAGTGGGCAAAGGACATGG + Intergenic
1155225651 18:23726911-23726933 TAAAAAGTGGGCAATGGGCCGGG - Intronic
1155395708 18:25384957-25384979 TAAAAAGTCAGGAAACGGCCGGG + Intergenic
1155469318 18:26173849-26173871 TAAAAAGTAGACAAAAGGCCGGG - Intronic
1155948031 18:31877625-31877647 AAAAAAGTGAGCCCATGGCCAGG + Intronic
1156224693 18:35092765-35092787 TAAAAAATGGGCAAAAGACTTGG + Intronic
1156561976 18:38135438-38135460 TAAAAAGTGGGCAAAGGGCCGGG - Intergenic
1157345826 18:46832119-46832141 TAAAAAGTGGGCAAAAGGCCAGG + Intronic
1157550488 18:48577934-48577956 TAAAAGGTGAGGAAATGTCCTGG - Intronic
1157553597 18:48598101-48598123 GAAACAGTGGGTAGATGGCCTGG + Intronic
1158130520 18:54147783-54147805 TAAAAAGCAGGCATATGGCTGGG + Intergenic
1158202292 18:54954350-54954372 TAAAAAGTAGGGTCATGGCCCGG - Intronic
1158224216 18:55183795-55183817 TAAAAATTGTATAAATGGCCAGG + Intergenic
1158699924 18:59736448-59736470 TAAGAAATGTGCAGATGGCCAGG - Intergenic
1159100847 18:63956406-63956428 TAAAAAGTGGCCAAAGGACATGG + Intronic
1159440002 18:68466076-68466098 TAAAAAGTGGACTTAGGGCCTGG - Intergenic
1159539003 18:69751707-69751729 TAAAATTTGCACAAATGGCCGGG + Intronic
1159751848 18:72312528-72312550 TAAAAAGTAGGCAAAGGACATGG - Intergenic
1159850452 18:73521000-73521022 TTAAAAATGGGCAAAAGGCCAGG + Intergenic
1160381360 18:78458586-78458608 TTAAAAGTGGGCAAGTGCCTGGG - Intergenic
1160470489 18:79128349-79128371 TAAAAAGTTGGCAAAAGGGATGG - Intronic
1160866001 19:1256186-1256208 TTAAAAGTGGGAAACTGGCCGGG + Intronic
1162228492 19:9244906-9244928 TTAAAAATGGGCAGAAGGCCAGG + Intergenic
1162251862 19:9451777-9451799 TAAAAAATGGGCAAATGGTTTGG + Intergenic
1163041390 19:14605389-14605411 TAAAATGTGGGGAGGTGGCCGGG - Intronic
1163042071 19:14610031-14610053 GAAAAAGTGGGCAGAGGGACAGG - Intronic
1163348556 19:16760553-16760575 TAAAATGTGGTGAATTGGCCAGG - Intronic
1163400457 19:17088971-17088993 CAGAAAGTGGGGATATGGCCAGG - Intronic
1163470671 19:17495268-17495290 AAAAAAATGGGCACATGGCTGGG - Intronic
1163599421 19:18239728-18239750 TTAAAACTGGGAAACTGGCCAGG + Intronic
1163890967 19:20012824-20012846 TAAAAAGTGGTCAAAGGACATGG + Intronic
1163995568 19:21042939-21042961 TAAAAAGTGGGCAAAGAACATGG - Intronic
1163996391 19:21051783-21051805 TAAAAAGTGGACTAATAGGCTGG - Intronic
1164006870 19:21157821-21157843 TAAAAAGTAGACAAATGGCCGGG - Intronic
1164280199 19:23762377-23762399 TAAAAAATGTCCAAATGGGCAGG + Intergenic
1165187096 19:34031754-34031776 CAAAAAGTGGGGAAGTCGCCGGG + Intergenic
1165263691 19:34642417-34642439 TTAAATGTGGGCAAAGGGGCCGG + Intronic
1165441930 19:35833392-35833414 TCCACAGTGGGCACATGGCCCGG + Intronic
1165479231 19:36052336-36052358 TAAAAAGCGGGCAACTGGCCAGG - Intronic
1165558020 19:36652919-36652941 TAGAAAATGGGCAAAAGGCATGG + Intronic
1165817758 19:38652788-38652810 TAAAATGTGGTCTTATGGCCGGG + Intronic
1165870251 19:38967160-38967182 TAAAAAATGGACAAAAGGCCGGG + Intronic
1165911250 19:39229668-39229690 TAGAAAATAGGCAAAAGGCCAGG + Intergenic
1165967156 19:39592125-39592147 AAAAAAGTGGGCAAAGGGGCCGG + Intergenic
1165972814 19:39647403-39647425 TAAAAAGTGGGCAAAGGGGCAGG + Intergenic
1165972876 19:39648056-39648078 AAAAAAGTGGGTAAAGGGCTTGG + Intergenic
1165978696 19:39701095-39701117 AAAAAAGTGGGCAAAGGGCTGGG + Intergenic
1166019290 19:40010973-40010995 TAGAAAATGGGCAGAAGGCCAGG - Intronic
1166025576 19:40081234-40081256 TAAAAAGTTGGCAAATGGGCTGG + Intronic
1166030613 19:40123690-40123712 AAAAAAGTGGGAAAATGACTTGG - Intergenic
1166278449 19:41773018-41773040 TAAAATGTGTACATATGGCCGGG + Intergenic
1166407778 19:42533818-42533840 TTAAAAATGGGCAAAGGGGCTGG + Intronic
1166598050 19:44068738-44068760 AAAAAAATGGGCAAAGGGCTGGG + Intergenic
1167231672 19:48288722-48288744 TTAAAAGTTGGGAAACGGCCGGG + Intergenic
1167704768 19:51074695-51074717 TAAAAAATGGACAAAGGGCCGGG + Intergenic
1167860438 19:52278698-52278720 TAAAAAGTGGGCAAAGGGCCAGG - Intronic
1167871803 19:52376803-52376825 CAAAAAGTGGGCTAAGGGCCGGG - Intronic
1168366599 19:55793271-55793293 TAAAAAGTTGGAAATAGGCCGGG + Intronic
1168489775 19:56798784-56798806 TAAAAAATGGGCAAAGGACGTGG + Intronic
925381800 2:3433357-3433379 TTAAAATTGGGCAAAGGGTCTGG + Intronic
925657467 2:6165386-6165408 TAAAAAGTGGGAGAATGGTTTGG + Intergenic
926969023 2:18447832-18447854 TAAAAAATGGGCAAAGGACATGG + Intergenic
927371739 2:22363424-22363446 TAAAAAGTGGGTAAAGGACACGG - Intergenic
927426722 2:22989327-22989349 CAAAAAGTGGGCAAAGGACATGG + Intergenic
927524279 2:23722994-23723016 TTAAAAATGGGCAAATAGCCAGG + Intergenic
927675352 2:25101641-25101663 TAAAATGAGGGGAAGTGGCCAGG - Intronic
927823927 2:26294112-26294134 TTAAAAATGGGCAAATAGGCTGG + Intergenic
928426761 2:31185172-31185194 TAAAAATTGGGGAAATGAACAGG + Intronic
928491143 2:31784606-31784628 TAAAAGGTGGGCAAAGAGGCTGG + Intergenic
928850478 2:35739486-35739508 TAAAAAGTGGGCAAAGGACATGG + Intergenic
928887347 2:36164938-36164960 TAAAAAGTTGACAATTGGCCAGG + Intergenic
929186800 2:39103982-39104004 TAAAAAATGGGCAATGGTCCAGG + Intronic
929595528 2:43173311-43173333 TAAAAAAAGGACAAATGGGCTGG - Intergenic
929713606 2:44289128-44289150 TTAACAATGGGCAAAGGGCCAGG - Intronic
929837618 2:45421210-45421232 TAAAATGTCAGAAAATGGCCAGG + Intronic
929869298 2:45744902-45744924 GAAAAACTAGGCAAATGGCTGGG - Intronic
930628346 2:53724301-53724323 TAAGAACTGGGCAAAAGGACTGG + Intronic
930783218 2:55244617-55244639 TAAAAAGAAGGAAATTGGCCAGG + Intronic
930906895 2:56580351-56580373 TAAAAAGTGAGCAGAGGGCATGG + Intergenic
931283404 2:60813145-60813167 TAATAAGTAGACAAGTGGCCAGG + Intergenic
931409429 2:62014858-62014880 TAAAAACTGCTGAAATGGCCGGG - Intronic
931416732 2:62088686-62088708 TAAAGAGTTGTCAAATGGTCAGG - Intronic
931431207 2:62210368-62210390 TTAAAAATGGGCAAAGGGCATGG + Intronic
931663205 2:64588878-64588900 TAAAATATAGGCAAATGGCTGGG - Intronic
931921845 2:67025890-67025912 TAAAAACTGGCTACATGGCCAGG + Intergenic
932076290 2:68666634-68666656 TAAAAAGTGGACAAAAGGTATGG + Intergenic
932095649 2:68846050-68846072 TTGAAAGTTGTCAAATGGCCTGG - Intergenic
932505870 2:72231539-72231561 TAAAAAATGGGCAAATAAACTGG + Intronic
932552249 2:72783663-72783685 TAAAAAGTGGGCAAAGGACATGG - Intronic
933188705 2:79308340-79308362 TTAAAAATGGACAAATGGGCTGG - Intronic
933305606 2:80594306-80594328 TAAAAAATGGGCAAAAGACTTGG - Intronic
933438426 2:82278477-82278499 TAAAAAGTGGGTAAAGGGCAAGG + Intergenic
933472711 2:82747321-82747343 TGAAAAGTGGGCAAAGGACATGG - Intergenic
933512614 2:83260222-83260244 TAAAAAGTGGGCAAAAGATATGG + Intergenic
933703286 2:85271405-85271427 TAAAAAATGGGAAACTGGGCCGG - Intronic
934664502 2:96160213-96160235 TAAAAAATGGACAAAGGGCTGGG + Intergenic
934759498 2:96845810-96845832 TAAAATGAGGGCAAAGGGGCCGG + Intronic
935040248 2:99419616-99419638 TAAAAAGTGCGCGACTGGACTGG + Intronic
935063379 2:99627393-99627415 TAAAAAGTAGGCAAAGGACATGG - Intronic
935294456 2:101636775-101636797 TAAAAACTGGTGAAATGGCTGGG - Intergenic
935296276 2:101652399-101652421 TAAAATATTAGCAAATGGCCGGG + Intergenic
935962003 2:108435139-108435161 TAAAAAGTCAGGAAATGGCCGGG + Intergenic
936101377 2:109583335-109583357 TAAAAAGTGGCCAAAAGACATGG + Intronic
936170223 2:110164330-110164352 TAAAAAGTAAGAAATTGGCCAGG - Intronic
936870671 2:117131756-117131778 CAAAAAATGGGCAAATGATCTGG + Intergenic
936874778 2:117175288-117175310 TTAAAAGTGGATAAAAGGCCAGG + Intergenic
937609818 2:123847415-123847437 GAAAAAGTGGGCAAATGGCTGGG + Intergenic
937683744 2:124672247-124672269 TAAAATGAGGGCAAATGGGTGGG - Intronic
937776012 2:125776234-125776256 TAAAAAGTAACCACATGGCCGGG - Intergenic
938008545 2:127809729-127809751 TAGAAAGTTGGCTTATGGCCGGG - Intronic
938377276 2:130816224-130816246 TAAAAAGAGGATAAAAGGCCAGG + Intergenic
938849769 2:135248608-135248630 TAAAAAGTGGGCGAAGGGCCTGG + Intronic
938970650 2:136428215-136428237 TTAAAAGTGAGGAATTGGCCAGG - Intergenic
939305677 2:140407503-140407525 TAAAAAGTGGGCAAATGACATGG + Intronic
939457331 2:142454520-142454542 TAAAAAGTCAGGAAATGGCTGGG + Intergenic
939822242 2:146971364-146971386 CAAAAAGTGGGCAAAGGACATGG - Intergenic
939823262 2:146982878-146982900 TAAAAAGTATGTAAATAGCCAGG - Intergenic
940194272 2:151076112-151076134 TAAAAAATGGGCAAAGGGACTGG + Intergenic
940553161 2:155187377-155187399 TAAAAAATGGGCAAAAGGCTGGG + Intergenic
940753919 2:157660121-157660143 TAGAAAGTCAGGAAATGGCCAGG + Intergenic
941663460 2:168219123-168219145 TAAAAAGTAGGCAGAGGGTCAGG + Intronic
941981365 2:171461147-171461169 AAAAAATTGGGAAATTGGCCAGG + Intronic
942275758 2:174322098-174322120 TAAAAACTTAGCAAAAGGCCGGG - Intergenic
942583701 2:177450131-177450153 TTAAAATTGGGCAAATAGGCTGG - Intronic
942806580 2:179938056-179938078 TAAAAAATGGGCAAAAGACATGG + Intergenic
943003679 2:182362453-182362475 TAAAAAGTGACCAACTGTCCTGG + Intronic
943225636 2:185170404-185170426 TAAAAAGTGGGCAAAAGACGTGG - Intergenic
943560715 2:189458216-189458238 TAAAAAGAAAGCAATTGGCCGGG - Intronic
943621533 2:190153188-190153210 GAAATAATGGGCAAGTGGCCGGG - Intronic
943893528 2:193322315-193322337 TAAAAAATGGGAATTTGGCCAGG - Intergenic
943938558 2:193959477-193959499 TAAAAAGTGGCAAAAAGGGCCGG - Intergenic
943948634 2:194100043-194100065 TAAGAAGTGTACAAATGTCCAGG - Intergenic
944342783 2:198622928-198622950 TTAAAAGTTGGCAAATAGCTGGG + Intergenic
944653155 2:201851952-201851974 TAAACAGTGGGCAAAGGGCCGGG - Intronic
944860017 2:203807004-203807026 CAAAGAGAAGGCAAATGGCCAGG + Intergenic
945279352 2:208021022-208021044 TAAAAAGTAGGCAGATAGACAGG - Intronic
945494877 2:210498246-210498268 TAAAAAATGGGCAAAAGACATGG - Intronic
945534630 2:210999763-210999785 TTAAAAATGGGCAAAAGACCTGG - Intergenic
945789658 2:214289061-214289083 TAAAAAGTGGGCAAAGGGCTGGG - Intronic
945885537 2:215371806-215371828 TAAAAAGTGGCTTCATGGCCGGG - Intronic
946461157 2:219870114-219870136 TAAAAAGAGGGCAAAAGCCTGGG - Intergenic
946490124 2:220140663-220140685 TAAAAAATGGGCAAAGGGGCTGG - Intergenic
947097875 2:226586894-226586916 TAAAAAGTGGGCAAAGGGCATGG - Intergenic
947626762 2:231624117-231624139 AAAAAATTGAACAAATGGCCGGG - Intergenic
948052554 2:234989504-234989526 TACGCAGTGGGCAAAGGGCCAGG - Intronic
948746726 2:240101558-240101580 TAAAAAGTGGGCAAAGGATACGG + Intergenic
948929225 2:241120189-241120211 TTAAAAGTAGGCAAAGGGGCAGG + Intronic
1169032543 20:2421596-2421618 TAAAATATGGGCAAAAGACCTGG - Intronic
1169115468 20:3062536-3062558 TAAAAAGTGGGCAAAGGGCTGGG + Intergenic
1169241599 20:3986046-3986068 TAAAAATAGAGAAAATGGCCAGG - Intronic
1169256443 20:4103560-4103582 TTAAAAATGGGCAAAGGGCTGGG + Intergenic
1169504833 20:6198285-6198307 AAAAAAATGGGGAAAAGGCCAGG - Intergenic
1169518927 20:6350353-6350375 CAAAAAGTGGGGTAAGGGCCGGG - Intergenic
1170410629 20:16087092-16087114 TTAAAAATGGGCAAATGATCTGG + Intergenic
1171176749 20:23056826-23056848 TAAAATGTGGGCAAAAGATCTGG + Intergenic
1171276855 20:23863791-23863813 TAAAAAGTGGGCATGGTGCCAGG - Intergenic
1172498441 20:35407130-35407152 AAAAAAGTAGGCAATAGGCCAGG + Intronic
1172927115 20:38547913-38547935 TAAAAAGCTGGAAAAAGGCCAGG - Intronic
1172961271 20:38801828-38801850 TAAAAAGTGGAAACAAGGCCGGG - Intergenic
1172961343 20:38802457-38802479 TAAAAAATGGGCAAGGAGCCTGG - Intergenic
1172969929 20:38865828-38865850 TAAAAAGTTGAAAAGTGGCCAGG + Intronic
1173179989 20:40799009-40799031 TAAAAAGCCGGCAGCTGGCCGGG + Intergenic
1173230158 20:41188694-41188716 TAAAAAGTGGGCAAAAGGTGGGG - Intronic
1173281203 20:41629666-41629688 TAAAAAGTAGGCAAAGGGCCAGG - Intergenic
1173307828 20:41867329-41867351 TAAAAAGCGGGCAAAGGACATGG - Intergenic
1173327205 20:42044906-42044928 TTAGAAGTGGGAAAAAGGCCAGG - Intergenic
1173604145 20:44318116-44318138 TTTAAAATGGGCAAATGGCTGGG + Intergenic
1174096726 20:48095771-48095793 TAAAAATTGTGGAAATGGGCTGG + Intergenic
1174227859 20:49018529-49018551 TAAAAAGTTGACAACAGGCCAGG - Intronic
1174322646 20:49754159-49754181 TAAAAAGTGAGTGAAAGGCCAGG - Intergenic
1174341383 20:49898697-49898719 TAAAAAGTGGGCAAAGGGCTGGG + Intergenic
1174523225 20:51149742-51149764 TAAAAAATGGGAAAAAGGCCGGG + Intergenic
1174530230 20:51206208-51206230 TGAGAAGTGAGCAAATGGCCCGG - Intergenic
1174859926 20:54081466-54081488 TTAAACGTTGGCAATTGGCCAGG - Intergenic
1175276910 20:57777724-57777746 TAAAAAGAAGGAAATTGGCCAGG - Intergenic
1175477118 20:59284605-59284627 TAAGAAGTGAGCAATGGGCCAGG - Intergenic
1175589615 20:60178079-60178101 TAAAAATTGGGATTATGGCCAGG + Intergenic
1175937700 20:62522115-62522137 TTAAAAATGGGCAAAAGGCCGGG - Intergenic
1176277621 20:64281510-64281532 TAAAAAGTTGGAAACAGGCCGGG - Intronic
1176387495 21:6146046-6146068 TTAAAAGTGAGCAGACGGCCGGG - Intergenic
1176764061 21:12997949-12997971 CAAAAAGTGGGCAAAGGACATGG - Intergenic
1177072997 21:16534456-16534478 GAAAAAGTGGGCAGCTTGCCAGG + Intergenic
1177104530 21:16938018-16938040 TTAAAAATGGGCAAAGGGGCTGG - Intergenic
1177306679 21:19327351-19327373 TCAAAAGTATGCAAAGGGCCAGG - Intergenic
1177971260 21:27792810-27792832 TAAAAAGTGGGCAAATGATATGG + Intergenic
1178427286 21:32488924-32488946 TAAAAAGTGGGCAAAGGACCTGG - Intronic
1178472568 21:32906502-32906524 TACAAAGTGGCCATATGGCAGGG - Intergenic
1178909218 21:36660821-36660843 TAGAAAGAGGGGAAAGGGCCGGG + Intergenic
1179588661 21:42390430-42390452 TAAAAAGGGGGAAAACAGCCGGG + Intronic
1179665523 21:42909435-42909457 TAAAAAGTGTGAAAGTGGCCGGG - Intronic
1179735977 21:43392202-43392224 TTAAAAGTGAGCAGACGGCCGGG + Intergenic
1180337201 22:11588314-11588336 TAAAAAGTGGCAAATTAGCCGGG - Intergenic
1180661556 22:17471828-17471850 TAAAAAATGTCCATATGGCCAGG - Intronic
1180753407 22:18142221-18142243 TTAAAAATGGGCAAATGGGCCGG + Intronic
1180808612 22:18739952-18739974 TAAAAACTGAGCATATGGCCGGG + Intergenic
1180828382 22:18883055-18883077 TAAAAACTGAGCATATGGCCGGG - Intergenic
1180909533 22:19439412-19439434 TCAAAAATGGGCAAGGGGCCGGG - Intronic
1181071538 22:20344916-20344938 TAAAAACTGAGCATATGGCCGGG + Intergenic
1181194608 22:21173866-21173888 TAAAAACTGAGCATATGGCCGGG + Intergenic
1181214835 22:21318912-21318934 TAAAAACTGAGCATATGGCCGGG - Intergenic
1181279941 22:21712418-21712440 TAAAAAATGGATAAAGGGCCGGG + Intronic
1181329948 22:22082505-22082527 TAAAAAGTGGACAAAGGACATGG + Intergenic
1181525216 22:23480055-23480077 TAAAAACTGAGCATATGGCCAGG - Intergenic
1181816369 22:25439999-25440021 TAAAAAATGGGCAAAGGGCCAGG - Intergenic
1182140487 22:27952357-27952379 TTAAAAATGGGCAAAAGGCCAGG - Intergenic
1182195526 22:28512118-28512140 TAAAAAGTGAGCAAAGGACATGG + Intronic
1182335209 22:29579588-29579610 TAAAAAGTACAAAAATGGCCGGG - Intronic
1182580815 22:31309700-31309722 TTAAATGTGGGTTAATGGCCAGG - Intergenic
1182725212 22:32439908-32439930 TAAAAACTGTGGCAATGGCCAGG - Intronic
1183119406 22:35718760-35718782 TAAAAACAGGGCACGTGGCCAGG + Intronic
1183643623 22:39108962-39108984 TCAAAAGGGGGAAACTGGCCAGG + Intergenic
1183686059 22:39362141-39362163 GAAAAAGGGGGAAATTGGCCGGG - Intronic
1184481378 22:44749825-44749847 TAAAAAGTGGGCAAGGGGCCAGG + Intronic
1184969336 22:48004040-48004062 AAAAAAGTGGACAAAATGCCAGG - Intergenic
1185104966 22:48863286-48863308 TAAAATGTGAACACATGGCCAGG + Intergenic
1203232275 22_KI270731v1_random:121270-121292 TAAAAACTGAGCATATGGCCGGG - Intergenic
1203278479 22_KI270734v1_random:109044-109066 TAAAAACTGAGCATATGGCCGGG - Intergenic
949384767 3:3489112-3489134 TAAAAAGTGGGCAAAGGGGAGGG + Intergenic
949889288 3:8721258-8721280 CAAAAAGTGGGCAAAGGACATGG + Intronic
949976095 3:9461585-9461607 GAAAAAGTAGGCAAATGACTTGG + Intronic
950209034 3:11104208-11104230 TAAAAAATGGGCAAAAGGGCTGG - Intergenic
950403830 3:12792077-12792099 TAAAAAGGAGGGAAATGGGCTGG - Intergenic
950807320 3:15617126-15617148 TAAAAAATAGGCAAAAGGCCGGG - Intronic
950845344 3:16010269-16010291 TAAAAAGTGGGCAAAAGACATGG + Intergenic
951222954 3:20088071-20088093 TAAAAACTAAGGAAATGGCCAGG - Intronic
952228193 3:31400897-31400919 TAAAAAGTGGGCAAAGGGCTGGG - Intergenic
952537666 3:34329394-34329416 TTAAAAATGGACAAAAGGCCTGG - Intergenic
952876499 3:37949113-37949135 TAGAAAGCTGGAAAATGGCCGGG - Intronic
953220230 3:40963537-40963559 TAAGAAGTGGGCAAAAGACATGG - Intergenic
953347710 3:42189928-42189950 AAAAATGTGGGCAAAATGCCTGG - Intronic
953540128 3:43810860-43810882 CAAACACTGGGCCAATGGCCTGG - Intergenic
953725155 3:45390933-45390955 TTAAAAATGGGCAAAGGGCCAGG - Intronic
954469586 3:50680797-50680819 TAAAAAGTAGGCAACAGGCTGGG - Intronic
955102775 3:55868320-55868342 TAAAAAGTGGGAAAATCCACTGG + Intronic
955258241 3:57357036-57357058 AAAAATGTGGAAAAATGGCCGGG - Intronic
955284345 3:57624441-57624463 TTAAAAGTAGTCAGATGGCCGGG - Intergenic
955299639 3:57765054-57765076 TAAAAAGAGGAAGAATGGCCAGG + Intronic
955980506 3:64521121-64521143 TAAAAAGTGGGCAAAGGACATGG + Intronic
957116802 3:76036797-76036819 GAAAAAGTGGAGAAATGGCCGGG - Intronic
957616812 3:82539596-82539618 TAAAAAGTAGGCACAAGGCAAGG + Intergenic
958005580 3:87806477-87806499 TAAAAAGTGGGCAAAGGACAAGG - Intergenic
958677757 3:97288895-97288917 TAAAAAGTGGGCAAAAGATATGG - Intronic
958759779 3:98293070-98293092 CAAAAAGAGGGCAAATGATCTGG - Intergenic
958849843 3:99311492-99311514 TAAAAAGCAAGCAAAGGGCCAGG + Intergenic
959124452 3:102273222-102273244 TAAAAACTGGGCAAAGGACATGG - Intronic
959262562 3:104100285-104100307 TAAAAACTGGGCAAAGGGGCTGG - Intergenic
959326812 3:104947151-104947173 TAAAAAGTGGGCAAAGGGCCAGG - Intergenic
959493958 3:107027152-107027174 CAAAAAGTGGGCAAATGACATGG + Intergenic
959687439 3:109163057-109163079 TAAAAAGTAGGTAATGGGCCGGG + Intergenic
960754298 3:120993116-120993138 TAAAAACTGGGCAAAAGACCAGG - Intronic
961190319 3:124955175-124955197 CAAAAAGTGGGCAAAAGGCTGGG - Intergenic
961402817 3:126658980-126659002 CTAAAAGTGGATAAATGGCCAGG + Intergenic
961998967 3:131274946-131274968 TAAAAAGTCAGGAAACGGCCGGG - Intronic
962538417 3:136352453-136352475 TAAAAACTGGACATTTGGCCAGG - Intronic
962582791 3:136813214-136813236 TTAAAAATAGGCAAAGGGCCAGG - Intergenic
962635499 3:137327190-137327212 TAAAAAGAGGGCACATAACCTGG - Intergenic
962821170 3:139048488-139048510 TAAAAAGTGGGCAAAGGATATGG - Intronic
963026178 3:140921652-140921674 TTAAAAATGGGCAAAAGACCTGG - Intergenic
963144891 3:141983339-141983361 TCAAAAATGGGCAAAGGGCCAGG + Intronic
963677021 3:148325084-148325106 TAAAAAGTGGACAAAAGACATGG + Intergenic
964564944 3:158039614-158039636 TAAAAAGTCAGGAAACGGCCGGG + Intergenic
964582397 3:158254725-158254747 TAAAAAGTCAGGAAACGGCCAGG - Intronic
964815226 3:160710411-160710433 TAAAACCTGGGCAAAAGGCAAGG - Intergenic
965378313 3:167954853-167954875 CATAAAGTGGGGAAAGGGCCGGG - Intergenic
965561538 3:170066432-170066454 TGAAAAGGGGAGAAATGGCCAGG - Intronic
965581841 3:170276943-170276965 TAAAAAATGAGCAAAGGGCTGGG + Intronic
965901928 3:173652088-173652110 TAAAAAGTGGGCAAAGGGGCCGG - Intronic
966080586 3:175995200-175995222 TAAAAAGTGGGCAAAGGGCTGGG - Intergenic
966193322 3:177290628-177290650 TACAAAGCGGGAAGATGGCCAGG - Intergenic
966511978 3:180774597-180774619 TAAAAAATGGGCAAAGGACATGG - Intronic
966519902 3:180861753-180861775 TAAAAAGTGAGCAAAGGGTGTGG + Intronic
966713411 3:182991914-182991936 TAAAAAGTGAAATAATGGCCGGG + Intergenic
967059630 3:185860735-185860757 TAAAAAGTGGGCAAATGGCCAGG + Intergenic
967498414 3:190168391-190168413 TAAAGAGGTGGCAGATGGCCAGG - Intergenic
967782435 3:193455041-193455063 TAAAAAGTGGGCAAAGGGCCGGG + Intronic
967997473 3:195177628-195177650 CAAAAAATGGGGAGATGGCCAGG + Intronic
968020864 3:195387750-195387772 TAAAAAGGGGAAAAATGGGCTGG - Intronic
968212895 3:196864108-196864130 TTAAAAATGGGCAAATGGCTGGG + Intergenic
969107022 4:4814876-4814898 TCAAAAGTGGGCAAAGGGTATGG + Intergenic
969920219 4:10531342-10531364 TAAGTAGTGCACAAATGGCCAGG - Intronic
970077073 4:12234726-12234748 TTAAAAATGGGCAAATGATCTGG - Intergenic
970624612 4:17863017-17863039 TAAAAAGTGGGCAAAGGGGTCGG + Intronic
971044373 4:22788783-22788805 TACAAAGTTGGCAAAGGGCTGGG - Intergenic
971062120 4:22984054-22984076 CAAAAAGTGGGCAAATGAATAGG + Intergenic
971437738 4:26645826-26645848 CAAAAAGTGGGCAAAGGGCCGGG + Intronic
971676291 4:29633856-29633878 TAAAAAGTGGGCAAAGGGGCCGG + Intergenic
971772127 4:30910487-30910509 TAAAAAGTGGGCAAAGGATATGG + Intronic
972464047 4:39335630-39335652 GAAAAAGTGGGGGAAAGGCCTGG + Intronic
972662220 4:41127683-41127705 TAAAAAGTGGGCAAAAGGCTAGG + Intronic
972813934 4:42622712-42622734 TAAAAAGTGGGAAAAGGGCTGGG + Intronic
973597654 4:52508989-52509011 TAAAAAGTGAGCAAAGGGAAGGG + Intergenic
973733172 4:53843293-53843315 AGAAAACTGGGCAAATGGGCTGG + Intronic
973761989 4:54126234-54126256 TAAAAAGAGTAAAAATGGCCAGG - Intronic
973876756 4:55227814-55227836 AAAAAAATGGGCAAAAGGCCAGG - Intergenic
974153185 4:58036856-58036878 TAAGAATAGGGGAAATGGCCTGG + Intergenic
974180013 4:58372179-58372201 TAAAAAGTGGGCAAAAGACATGG - Intergenic
974247160 4:59334425-59334447 TAGCAAATGGGAAAATGGCCAGG + Intergenic
974352706 4:60770877-60770899 TAAAAAGTGGGGCACAGGCCAGG - Intergenic
974430729 4:61792781-61792803 AAAAATGTGGGAAAGTGGCCAGG - Intronic
974472849 4:62340503-62340525 TAAAAAGTGGGCAAAAGGCAGGG + Intergenic
974519004 4:62956827-62956849 CAAAAAGTGGTCAAAGGGCATGG + Intergenic
975388298 4:73785313-73785335 TAAAAAATGAACAAATGGGCTGG + Intergenic
975755789 4:77570433-77570455 TAAAAAGTGGGCAAAGGGCTAGG + Intronic
975927702 4:79478194-79478216 TAAAATGTGGGCAAAGGGCCAGG - Intergenic
976117135 4:81739850-81739872 TAAAAAGTGTTAAAATGCCCAGG - Intronic
976877131 4:89866805-89866827 TAAAAAGTCAGGAAATGGCCTGG - Intergenic
977001527 4:91510644-91510666 TAAAAAGTGAACAAATGACATGG - Intronic
977053798 4:92163545-92163567 TTAAGAGCGGGCAAGTGGCCTGG - Intergenic
977314794 4:95432230-95432252 TATAATGAGAGCAAATGGCCCGG - Intronic
977453885 4:97233402-97233424 TAAAAAATGGGCAAAGGACCTGG + Intronic
977661418 4:99590950-99590972 TTAAAATTAGACAAATGGCCTGG - Intronic
978949560 4:114541322-114541344 TAAAAAGTGGGCAAAGGACATGG + Intergenic
979287390 4:118941537-118941559 TAAAAAATGTATAAATGGCCTGG - Intronic
979378091 4:119973071-119973093 TTAAAAATGGGCAAAGGGCCAGG + Intergenic
979650396 4:123123650-123123672 TAAAAAGTCAGGAAACGGCCGGG + Intronic
979658200 4:123221627-123221649 TAAAAAATGTAAAAATGGCCAGG + Intronic
979861454 4:125698480-125698502 TAAAAAGTGGGCAAAGGACTGGG + Intergenic
980118611 4:128705261-128705283 TAAAAAGTAGGCAAAGGGCCAGG - Intergenic
981321654 4:143398762-143398784 TATAAAATGGGCAGCTGGCCAGG + Intronic
981523634 4:145690803-145690825 CAAAAAGTGCACAAAGGGCCAGG + Intronic
981626775 4:146765751-146765773 GTAAAATTGGGCAAATGCCCAGG - Intronic
981960888 4:150537653-150537675 TAAAAAGTGAACAAAGGACCGGG + Intronic
982187354 4:152816037-152816059 AAAGAAGTGGTCAGATGGCCGGG - Intronic
982703020 4:158676872-158676894 TAAAAAGTGGGCAAAGGATCTGG - Intronic
982735469 4:159002138-159002160 TAAAAAGTGGGCAAGTGATAAGG - Intronic
983144090 4:164190545-164190567 TAAAAAGTGGGTAAAAAACCTGG + Intronic
983366680 4:166799884-166799906 TAAAAAGTATGAAAATGGCCGGG + Intronic
983489592 4:168372730-168372752 TAAAAAGTGGGGAAAGGGAGGGG + Intronic
983996306 4:174186862-174186884 TTAAAAGTGGGCAAAAGACTTGG + Intergenic
984106824 4:175558069-175558091 TAAAAAGTGGACAAAGGGCCGGG - Intergenic
985114203 4:186575284-186575306 TTAAAAATGGGCAAAGGGCCGGG + Intergenic
985325263 4:188760824-188760846 TAGAAAGTGGGCAAAGGACATGG - Intergenic
986432367 5:7693716-7693738 TAAAAAGTAAGCAGATGGCCGGG - Intronic
986705026 5:10447579-10447601 TCAAAAGTGGGAAGACGGCCAGG + Intronic
986822175 5:11479816-11479838 TAAAAAGTGGGCAAAGGACATGG - Intronic
987351876 5:17029553-17029575 TAAAAAGTGGGCAAATGGCCGGG + Intergenic
987416538 5:17668115-17668137 TAAAAAGTGCAAAATTGGCCAGG - Intergenic
987430388 5:17825768-17825790 TAAAAATTGGGCAAAAGGCTGGG + Intergenic
987438107 5:17922520-17922542 TTAAAAGAGTGCAAAAGGCCAGG - Intergenic
987716730 5:21580907-21580929 CAAAAAGTGGGCAAAGGACATGG + Intergenic
987858520 5:23452871-23452893 TGACAAGTGGAGAAATGGCCTGG + Intergenic
987982998 5:25112540-25112562 TAAAAAGTGGGCAAAGGACATGG + Intergenic
988478996 5:31613766-31613788 TAAAAAGAGGGTAAAGGGCCAGG - Intergenic
988890879 5:35616292-35616314 TAAAAAGTGTGCAAAGGACACGG + Intergenic
989268511 5:39504866-39504888 TAAAAACTAGGCAATTGGCCAGG - Intergenic
989447770 5:41550917-41550939 TAAAAAATGGGCAAAGGACATGG + Intergenic
989669757 5:43901795-43901817 TAAAAAGTAGGCAAAAGATCAGG - Intergenic
989712603 5:44418034-44418056 GAAATGGTGGGCAAATGGTCTGG - Intergenic
990022660 5:51146732-51146754 TAAAAAATGGGCAAAGGACATGG + Intergenic
990454516 5:55972214-55972236 TTAAAAATGGGCAAATGGGCTGG + Intronic
990605013 5:57400507-57400529 TAAAATATGGGCAAATGATCTGG - Intergenic
990745133 5:58951294-58951316 TAAAAAGTGGGTAAAGGGCCAGG + Intergenic
990754443 5:59052764-59052786 TAAAGTGTGGGAAAATGGCCTGG - Intronic
990899402 5:60734309-60734331 TAAAAAGTCAGGAAATGGCTGGG + Intergenic
991244216 5:64491762-64491784 TAAAAACTGGGCAAAGGACATGG + Intergenic
991703757 5:69338592-69338614 AAAAATGTGTGCAATTGGCCAGG - Intergenic
991721156 5:69494815-69494837 TTAAAAGTGGGCAAATGCCGTGG + Intronic
991985054 5:72276734-72276756 TAAAAAGTGAGCAAAGCGCCAGG + Intronic
992274033 5:75096328-75096350 TAAAAAGTGAGCAAAGGACATGG - Intronic
992437488 5:76769405-76769427 AAAAAAGTGGGCAAAGGACTGGG + Intergenic
992685734 5:79197742-79197764 TAAAAAGTGCTCACTTGGCCAGG + Intronic
992827480 5:80564999-80565021 TAAAAAGTGAGCAAACAGGCTGG - Intronic
993009468 5:82463799-82463821 TAAAAAATGGGCAAAAGTCGTGG + Intergenic
993156172 5:84227257-84227279 TAAAAATTGGGCAAAGGACATGG + Intronic
993207924 5:84908801-84908823 CAAAAAGTGAGCAAATGACATGG - Intergenic
993262558 5:85678379-85678401 TAAAAAGTGGGCAAAAGACCTGG + Intergenic
993331119 5:86601409-86601431 TAAAAAGTGGGCAAAGCACATGG + Intergenic
993413439 5:87598768-87598790 TAAAAAGTGGGCAAAGGACACGG - Intergenic
993797734 5:92289109-92289131 TAAAAAGTGGGCAAAATTTCTGG - Intergenic
993857716 5:93096729-93096751 TAATAAATTGGGAAATGGCCAGG + Intergenic
994053296 5:95387080-95387102 TAAAAAGTAGGCAAAGCGCCGGG + Intergenic
994319195 5:98370820-98370842 TTAAAAATGGGCAAAGGACCTGG - Intergenic
994430040 5:99646770-99646792 TAAAAAGTGAGCAAATAGTATGG + Intergenic
994541093 5:101098609-101098631 TAAAAACTGGGCAAATGACAAGG + Intergenic
994660416 5:102647389-102647411 TAAAAAATGGGCAAAAGGGCTGG + Intergenic
994731693 5:103499220-103499242 TAAAAAGAGGACAAATAGCAGGG - Intergenic
994810496 5:104511905-104511927 AAAAAAATGAGCAAATGGTCAGG - Intergenic
994904724 5:105824251-105824273 TAAAAAGGGGGGAATAGGCCAGG + Intergenic
994951501 5:106469566-106469588 TTAAAAATGGGCAAAAGACCTGG + Intergenic
995569272 5:113462227-113462249 TAGAAAGTGGGTGAATGGCTGGG - Intronic
995617492 5:113981975-113981997 TAAAAGGTGGGCAAAGGACATGG - Intergenic
995626740 5:114087091-114087113 TTAAAAATGGGCAAAGGGACAGG - Intergenic
996000818 5:118361477-118361499 TAAAAAGTAGGCAAAGGGCTGGG + Intergenic
996028683 5:118681077-118681099 ATAAAAATGGGCAAATGGCCAGG - Intergenic
996303953 5:122024570-122024592 TAAAATGTGAGTAAAAGGCCTGG - Intronic
997247690 5:132364897-132364919 TAAAAAGCATGCAATTGGCCAGG + Intergenic
997390004 5:133506914-133506936 TAAAAAGCAGGCAATAGGCCAGG + Intronic
997455394 5:134013645-134013667 TAAAAAGTGGGCAGAGGGCTGGG + Intergenic
997498610 5:134352742-134352764 TAAAAATTGGGCAAAGGACCAGG - Intronic
997757259 5:136410749-136410771 TAAAAAGTCAGGAAACGGCCGGG - Intergenic
997887050 5:137639397-137639419 CAAAAACTGTGCAAGTGGCCGGG + Intronic
998289189 5:140896670-140896692 CAAAAAATGGGCAAAGGGCCGGG - Intronic
998845025 5:146300117-146300139 TAAGAAGTAGGCAAAGGGCTGGG - Intronic
999020350 5:148158711-148158733 TAAAAAGCGGCCAAAGGGGCTGG - Intergenic
999055982 5:148577140-148577162 TAAAAAGTGGGCAAAGGACAGGG + Intronic
999506224 5:152199912-152199934 TAAAAAATGGGCAAAAGGTTTGG - Intergenic
999851743 5:155547897-155547919 TAAAAAGTGGGCAAAAGACATGG - Intergenic
1001343778 5:170871345-170871367 CAAAAAGTGGGCAAATGTAGTGG - Intronic
1001385366 5:171334237-171334259 TAAAAAATGGACTAATGGCCAGG + Intergenic
1001637305 5:173220242-173220264 TAAAAAGGGGGAAGCTGGCCAGG - Intergenic
1001645755 5:173280917-173280939 TAAAAAGTGAGTAAACGGCCCGG + Intergenic
1001660314 5:173386479-173386501 TAAAAAGAGGTAGAATGGCCAGG + Intergenic
1001703775 5:173726851-173726873 CAAAAAGTGGGCAAAAGACATGG + Intergenic
1002236386 5:177806676-177806698 TAGAAAGTGGGTAAATGGAGGGG - Intergenic
1002408893 5:179058383-179058405 TTAAAAATGGGCAAAGGGCTGGG - Intergenic
1002513678 5:179740894-179740916 AAAAAAGAGTGAAAATGGCCAGG - Intronic
1003027502 6:2568939-2568961 ATAAAAATGGGCAAAAGGCCAGG - Intergenic
1003145565 6:3507491-3507513 TTAAAAGTGGGCAAAAGTCATGG - Intergenic
1003204588 6:3995546-3995568 TAAAAAGTGTGTAACTGGCTAGG + Intergenic
1003355257 6:5363220-5363242 TTAAAAATGGGCAAAGGGGCTGG - Intronic
1003505119 6:6734317-6734339 TAAAAAGTGGGCAGATCTCTTGG + Intergenic
1004077111 6:12353853-12353875 TAAAAAGTGGACAAAGGGACAGG - Intergenic
1004352283 6:14900780-14900802 TAAAAAGTGGGCAAAGGGCTGGG + Intergenic
1004606085 6:17196149-17196171 TAAAAAGGGAGGAAAAGGCCGGG - Intergenic
1004611557 6:17246071-17246093 TAAAAAGTGGGCAAATGGCCAGG + Intergenic
1004614224 6:17274720-17274742 TAAAAAGTGGTCAAAGGGGTGGG + Intergenic
1004739224 6:18441187-18441209 GATAAAGTGGGAAAATGGCAGGG - Intronic
1004949285 6:20650373-20650395 TAAAAAGTGGGCAAAGCACATGG - Intronic
1005151867 6:22760843-22760865 TAAAAAGTGGTCAAAGGACATGG - Intergenic
1005502179 6:26438564-26438586 TTAAAAATGAGCAAATGGGCTGG + Intergenic
1005513346 6:26531572-26531594 AGAAAAGTGGGGAATTGGCCGGG + Intergenic
1006489849 6:34378009-34378031 CAAAAAGCGGAAAAATGGCCAGG + Intronic
1006560113 6:34903809-34903831 TAAAAATTAGGCAGATGGGCTGG - Intronic
1006675806 6:35762248-35762270 TAAAAAATGGGCAAATGGGCTGG + Intergenic
1006712660 6:36088425-36088447 TAAAAAGTTGGCAAAGGGCCAGG + Intronic
1006774807 6:36584012-36584034 TAAAAAATGAGTAAATGGGCCGG - Intergenic
1006783170 6:36646252-36646274 TAAAAAATGGGGAGATGGGCTGG + Intergenic
1007027865 6:38596503-38596525 TAAAAAGTGGGCTCTTGGCCAGG + Intronic
1008143652 6:47862506-47862528 AAAAAAATTGACAAATGGCCAGG - Intergenic
1008158389 6:48046240-48046262 TTAAATGTGGGCAAATGTCTGGG - Intronic
1008517616 6:52332990-52333012 TAGAAAATGGGCATATGGCTAGG + Intergenic
1008550452 6:52624800-52624822 TAAAAAATGGGTAAAGGGCCGGG + Intergenic
1008736617 6:54552311-54552333 TAAAAAGTGGGCAAAGGACATGG + Intergenic
1009372017 6:62916948-62916970 AAAAAAATGGGCAAATGGCTGGG + Intergenic
1009583295 6:65564948-65564970 TAAAAAGTGGGTGAACGGCCGGG + Intronic
1009660929 6:66610162-66610184 CAAAAAGTGGGCAAAGGACATGG + Intergenic
1009663995 6:66652670-66652692 CAAAAAGTGGGCAAAGGACATGG - Intergenic
1009770679 6:68139608-68139630 TAAACAGTGGACATATGGCAAGG + Intergenic
1009897618 6:69772641-69772663 TAAAAAGGGGGAAAAGGGGCAGG + Intronic
1010412529 6:75577191-75577213 CAAAAAGTTAGAAAATGGCCAGG + Intergenic
1010546965 6:77170889-77170911 TAAAAAATGGGCAAAGGACATGG - Intergenic
1010647757 6:78413105-78413127 AAAAAAAAGGGCAACTGGCCAGG + Intergenic
1010985246 6:82415930-82415952 TACAAAGTTGGCAAATTGGCAGG + Intergenic
1011079217 6:83471233-83471255 TAAAAACTGGGCAAACAGCCTGG - Intergenic
1011305331 6:85919389-85919411 CAAAAAGTGGGCAAAGGACATGG - Intergenic
1011557022 6:88581239-88581261 TAAAAACTGAACAAATGGCCGGG - Intergenic
1011592070 6:88979491-88979513 TAAAAAGTGGGCAAATGGCTGGG - Intergenic
1011658795 6:89576343-89576365 TGAAAGTTGTGCAAATGGCCAGG - Intronic
1011921475 6:92582318-92582340 TAAAAAGTGGTCAAAGGACACGG + Intergenic
1012203064 6:96429756-96429778 TAAAAAGTGGGCAAAGAACATGG - Intergenic
1012502768 6:99907835-99907857 TAAAAAGTGGACAAAAGATCTGG + Intergenic
1012515660 6:100055857-100055879 TTAAAAATGGGCAAAGGGCTGGG - Intergenic
1012808228 6:103923052-103923074 TAAAAAGTGCTCAAATGGAAAGG + Intergenic
1012830972 6:104202998-104203020 AAAAAAGAGCGCATATGGCCAGG + Intergenic
1012951982 6:105527914-105527936 TAAAAAGTAGGCAAAAGACATGG + Intergenic
1013314891 6:108932058-108932080 CAAAAAGTGGGCAAAGGGCCAGG - Intronic
1013656089 6:112248203-112248225 TAAAAATAGTTCAAATGGCCAGG + Intronic
1013932446 6:115550340-115550362 TACAAAGTGGGCAAAGGACATGG + Intergenic
1013991611 6:116260303-116260325 TAAAAAGTGGGCAAAGGACATGG - Intronic
1014367691 6:120564482-120564504 TAAAAAGTGGGCAAAGGACATGG + Intergenic
1014412818 6:121147947-121147969 TAAAAAATGGGCAAAGGACATGG - Intronic
1014757068 6:125313133-125313155 TAAAAGTTAGGCAAGTGGCCAGG + Intergenic
1015148993 6:130018889-130018911 AAAAAAGTGGGCAAGTGACTCGG + Intronic
1015169713 6:130239052-130239074 TAAAATCTGGGAAACTGGCCAGG - Intronic
1015668218 6:135656123-135656145 CAAAAAGTGGGCAAAGGACCTGG - Intergenic
1015737230 6:136413951-136413973 TAAAAATTGGTTAAATGGGCCGG + Intronic
1015850478 6:137566761-137566783 TAAAAAGTGGGCAAAGGATATGG - Intergenic
1017090969 6:150758628-150758650 TAAAAAGTCAAGAAATGGCCAGG - Intronic
1017143347 6:151212057-151212079 TAAAAAGTGGGCAAATGGCCAGG + Intergenic
1017143403 6:151212503-151212525 TAAAAAGTGGGCAAATGGCCAGG - Intergenic
1017147594 6:151248692-151248714 TAAAAAGTGGGTTGCTGGCCGGG + Intronic
1017586175 6:155926452-155926474 TAAAAATTTGGCAAATGATCTGG - Intergenic
1017621511 6:156304081-156304103 TAAAAAGTGGAAACTTGGCCGGG - Intergenic
1017637745 6:156459704-156459726 TAAAAAATGTGGAAGTGGCCAGG + Intergenic
1017690594 6:156960222-156960244 TAAGAAGGGGACAAGTGGCCAGG - Intronic
1017960891 6:159219335-159219357 AATAAAGAGGGGAAATGGCCGGG - Intronic
1019426227 7:978220-978242 TAAAAAGTGGGGAAGGGGCTGGG + Intergenic
1020341844 7:7119878-7119900 AAAAAATTGGGCAGATGGCAAGG - Intergenic
1020425726 7:8063920-8063942 TAAAAAGTGGGCAAATGGCCAGG - Intronic
1020658376 7:10953953-10953975 TAAAAAGTGGGCAATAGGCCAGG - Intergenic
1020693155 7:11383413-11383435 TCAACTGTGTGCAAATGGCCTGG + Intronic
1020772409 7:12411380-12411402 TAAAAAATGGGCAAAGGATCTGG - Intergenic
1021064705 7:16159119-16159141 TAAAAATTGGGAGAGTGGCCGGG + Intronic
1021383292 7:19995321-19995343 TAAAAAGTGCACAAAGGGCATGG - Intergenic
1021660494 7:22914583-22914605 CAAAAAATGGGCAAATGGTCTGG + Intergenic
1021946071 7:25728569-25728591 TAACAAGTGAGGAAATGGCTCGG - Intergenic
1021983863 7:26080685-26080707 TAAAAACTGGCCATATGGGCTGG + Intergenic
1022169845 7:27815030-27815052 TAAAAACTAGGAAAATGGCCGGG - Intronic
1022172922 7:27846770-27846792 TAAAAAATGGGCAAAGGACCTGG - Intronic
1022268236 7:28780063-28780085 TAAAAAGTATGCACATGGCTGGG - Intronic
1022293638 7:29028667-29028689 TAAAAAGTGAGAAAAGGGCCAGG + Intronic
1022364740 7:29701345-29701367 TATAAACTGAGCAAATTGCCAGG - Intergenic
1022912377 7:34911416-34911438 CAAAAAGTGGGCAAAGGACATGG + Intergenic
1022933291 7:35145003-35145025 TATAAACTGAGCAAATTGCCAGG + Intergenic
1023226563 7:37975807-37975829 TAAAAGAAGGGCAAGTGGCCAGG + Intronic
1024129044 7:46331242-46331264 CAAAAAGTGGGCAAAGGGGCCGG - Intergenic
1024187174 7:46962274-46962296 TAAAAAGTCAAAAAATGGCCAGG + Intergenic
1024451957 7:49557511-49557533 TAAAAAGTGGGCAAAGGACAAGG + Intergenic
1024621986 7:51168237-51168259 CAAAAAATGGGCAAAAGGCCGGG + Intronic
1024933621 7:54690257-54690279 TAAAAAGAGGGCAGAAGGCAGGG - Intergenic
1025153426 7:56579943-56579965 TAAAAAATGGGCAAATAACTAGG - Intergenic
1025213475 7:57035265-57035287 TAAAAATTGATCAATTGGCCGGG + Intergenic
1025252606 7:57361844-57361866 CAAAAACTGGGAAAGTGGCCAGG + Intergenic
1025520660 7:61725401-61725423 CAAAAAGTGGGCGAAGGGGCCGG + Intergenic
1025658478 7:63541558-63541580 TAAAAATTGATCAATTGGCCGGG - Intergenic
1026475436 7:70731060-70731082 TTAACAGTGGGCAAATGGGTGGG - Intronic
1026603373 7:71795317-71795339 GAAAAAGAGGGAAGATGGCCGGG - Intronic
1026731558 7:72915963-72915985 CAAAAAGTGGGCAAAGGGCCAGG - Intronic
1026775564 7:73229073-73229095 AAAAAAGTTGGGAAAAGGCCAGG + Intergenic
1026816794 7:73519909-73519931 TAAAAAGTAGGGTACTGGCCAGG + Intronic
1027016421 7:74782445-74782467 AAAAAAGTTGGGAAAAGGCCAGG + Intronic
1027071607 7:75163491-75163513 AAAAAAGTTGGGAAAAGGCCAGG - Intergenic
1027112481 7:75451869-75451891 CAAAAAGTGGGCAAAGCGCCAGG + Intronic
1027284726 7:76636475-76636497 CAAAAAGTGGGCAAAGCGCCAGG + Intergenic
1027300855 7:76833094-76833116 TGATAAGTGGGCAAATGGTATGG + Intergenic
1027506849 7:79026576-79026598 TAAAAAATGGGCAAGAAGCCAGG + Intronic
1027507771 7:79039683-79039705 TAAAAAGTGGGCAAAGAGGTTGG + Intronic
1027828130 7:83142661-83142683 TAAAAAGTGCAAACATGGCCAGG + Intronic
1028205153 7:88008074-88008096 CAAAAAGTGGGCAAAGGACATGG + Intronic
1028367201 7:90047777-90047799 TAAAAACTGGGCAAAGGACCTGG + Intergenic
1028394947 7:90358917-90358939 TAAAAAGTGGACAAATGACATGG + Intronic
1028700527 7:93773602-93773624 TTAAAAGTGGGCAAAGGACTTGG + Intronic
1028913292 7:96231427-96231449 TAAAAAGTGGGGGAAAGGCCAGG + Intronic
1028996401 7:97105133-97105155 TTAAAAGGGGTCAAATGGGCTGG + Intergenic
1029256302 7:99271991-99272013 TAAAAAGAGGGAAGATGGGCTGG - Intergenic
1029294686 7:99530481-99530503 CAAAAAGTAGGCAAATGACATGG - Intronic
1029554872 7:101261697-101261719 TAAAAAATGGGCAACTCGTCCGG - Intergenic
1029683813 7:102131356-102131378 TAAAAATTGCTCAATTGGCCAGG + Intronic
1029684465 7:102136682-102136704 TAAAAGTTGGTAAAATGGCCGGG - Intronic
1029829217 7:103237768-103237790 TATAAACTGAGCAAATTGCCAGG + Intergenic
1030030186 7:105362310-105362332 TAAAAAGTCAGGAAATGGCCGGG + Intronic
1030068848 7:105681129-105681151 TTAAAAATGGGCAAAGGGCTGGG + Intronic
1030362290 7:108607671-108607693 AAGAAATTGGGCAAATGGACTGG - Intergenic
1030376743 7:108761313-108761335 TAAAAAGTGGGCAAAGGACATGG + Intergenic
1030398365 7:109016868-109016890 TAAAAAGTGGGCAAAAGGCTGGG - Intergenic
1030529187 7:110691635-110691657 CAAAAAGTGGGCAAAGGACATGG + Intronic
1030530510 7:110706666-110706688 TAAAAAGTGGGCAAAAGACATGG - Intronic
1031066199 7:117107908-117107930 CAAAAAGTGGGCTAAGGGCCGGG - Intronic
1031219971 7:118952658-118952680 TCAAAAATGGGCAAAGGGCCAGG - Intergenic
1031515772 7:122696428-122696450 CAAAAACTGGGCAAATGACCAGG - Intronic
1031518035 7:122725631-122725653 TAAAAAGTCAAAAAATGGCCAGG + Intronic
1031771653 7:125851566-125851588 GAAAAAGTGGGCAGGTGGGCAGG + Intergenic
1032142590 7:129346456-129346478 TAAAAAGTGGGCAAAAGACATGG + Intronic
1032408965 7:131679269-131679291 TAAAAAGTTGGAAACTTGCCGGG + Intergenic
1032652810 7:133896957-133896979 TAAATAGTGGGCAACTGGGCCGG - Intronic
1032809485 7:135396410-135396432 TAAAAAGAGAGGAGATGGCCGGG - Intronic
1033019905 7:137713933-137713955 TCAAAATTGGGCAAGTGGCCAGG - Intronic
1033363077 7:140651598-140651620 TAAAAAGTGTGAGAAAGGCCGGG - Intronic
1033396656 7:140980531-140980553 TAAAAAATGGGCAAAAGACATGG - Intergenic
1033730597 7:144175058-144175080 TAAAAACTGAGCAAATAGCTGGG - Intergenic
1033780539 7:144664081-144664103 TAAAAAGTGGGCAAAGGGCCGGG + Intronic
1034101208 7:148452097-148452119 TAAAAGGTGGGCTAAGGGCCGGG - Intergenic
1034720136 7:153284774-153284796 TAAAAAGTTGGAAAATGACCTGG + Intergenic
1034962691 7:155372533-155372555 TAAAACGTGGGCACCTGTCCGGG - Intergenic
1035531865 8:358714-358736 TAAAAAGTGGGGGATGGGCCAGG - Intergenic
1035645758 8:1217919-1217941 TAAAAAATGGGCAAAGGACATGG - Intergenic
1035715410 8:1750546-1750568 TAGAATGTGGACAATTGGCCAGG - Intergenic
1035756745 8:2039401-2039423 AAAAAAATGGGCAAAAGGCCTGG + Intergenic
1036141074 8:6208826-6208848 TAAAAAGGGATAAAATGGCCGGG - Intergenic
1036524407 8:9521425-9521447 TAAAAAGTGGAAATTTGGCCAGG + Intergenic
1036634009 8:10535888-10535910 TAAAAAATGGGCAGAGGGGCCGG + Intronic
1036836724 8:12076782-12076804 TAAAAACCTGGGAAATGGCCGGG + Intergenic
1037222633 8:16543995-16544017 TTAAAAATGGGCAAATAGGCCGG + Intronic
1037840028 8:22238208-22238230 AAAAAAGTGTGGATATGGCCAGG + Intergenic
1038142107 8:24856999-24857021 TAAGAACTGGGCAATTGGCTAGG + Intergenic
1038808974 8:30820418-30820440 TAAAAAGTGGGTAAAAGTCCAGG - Intergenic
1038918722 8:32057402-32057424 TCAAAGGTGTGCACATGGCCTGG + Intronic
1039331693 8:36544444-36544466 TAAGAAATGGGCAAAGGGGCTGG + Intergenic
1039370381 8:36978320-36978342 CAAAAATTAGGCAATTGGCCAGG - Intergenic
1039383450 8:37107794-37107816 TAAAATGTGTGCTATTGGCCAGG + Intergenic
1039631407 8:39115561-39115583 TAAAAAATGGGCCAATGACATGG - Intronic
1039678640 8:39702953-39702975 AAAAAAGAGTCCAAATGGCCAGG - Intronic
1039796644 8:40921305-40921327 TAAAAAGTGGGGAGGAGGCCGGG + Intergenic
1040412958 8:47173037-47173059 TAAAAAGTGGGCAAAAGGCTAGG + Intergenic
1040519466 8:48162756-48162778 TTAAAAGTAGGCAAAGGGGCTGG - Intergenic
1040562083 8:48531880-48531902 TAAAAAATATGCAAAAGGCCAGG - Intergenic
1040624935 8:49136483-49136505 TAAAAAGTGAGCAAAAGACCAGG - Intergenic
1040672662 8:49711460-49711482 TAAAAAGTGGGCAAAGAGCTGGG + Intergenic
1041063534 8:54059597-54059619 TTAAAACAGGGAAAATGGCCGGG - Intronic
1041180715 8:55245200-55245222 TAAAAAGTAGGCAAAGGGCCGGG - Intronic
1041266061 8:56066271-56066293 AAAAAAATGGGCAAACAGCCAGG + Intergenic
1041325371 8:56658030-56658052 TAAAAAGGGGCCCAATGGCAAGG - Intergenic
1041459910 8:58099986-58100008 GAAAGAGTGGGCAAATTGACAGG - Intronic
1041516978 8:58711363-58711385 TAAAAAGTCAGCTAATGGCCGGG + Intergenic
1041681391 8:60596625-60596647 TAAAAAGTGAGGAAACGGCCGGG + Intronic
1041708829 8:60874921-60874943 AAAACACTGAGCAAATGGCCAGG + Intergenic
1042139103 8:65661666-65661688 TTAAAAATGAGCAAAAGGCCAGG + Intronic
1042266439 8:66913667-66913689 TAAAAAGTGAACACATGGGCCGG + Intronic
1042447387 8:68902065-68902087 TAAAAAGTGGGCAAAGAACATGG + Intergenic
1042538157 8:69880044-69880066 TTAAAAATGGGCAAGAGGCCAGG - Intergenic
1042901056 8:73728017-73728039 TAAAAAATGGGCAAAGGACTTGG - Intronic
1043274787 8:78379404-78379426 TTAAAACTGGGCAACAGGCCAGG + Intergenic
1043366604 8:79540432-79540454 AAAAAAGTGGGCAAAGGGCCAGG - Intergenic
1043526575 8:81104197-81104219 TAAAAAGAGAGCAAAGGGACAGG - Intronic
1043631369 8:82339314-82339336 AAAAAAGTGGGCAAGTGTGCTGG - Intergenic
1044055723 8:87567221-87567243 TAAAATATCAGCAAATGGCCCGG - Intronic
1044377595 8:91494723-91494745 TAAAAAGTCAGGAAATGGCCGGG - Intergenic
1044554723 8:93550734-93550756 TTAAAACTAGGCAAATGGCTGGG + Intergenic
1045164942 8:99593235-99593257 TAAAAAGTGGGCCAAAGACGTGG + Intronic
1045674404 8:104590833-104590855 TTAAAAGGGGGCAAATCGGCAGG - Intronic
1045945765 8:107794319-107794341 TAAAAAGTGGGCAAATGGGCCGG + Intergenic
1045987872 8:108270577-108270599 TAAAAAATGGGCAAAGGACTTGG - Intronic
1046188071 8:110748930-110748952 TAAAAATTGGGCAAAGAGGCTGG + Intergenic
1046413278 8:113876572-113876594 TAAAAAGTGGGCAAAGGGCTAGG - Intergenic
1046495329 8:115006440-115006462 TAAAAAGTGAGAAAAAGGCTGGG - Intergenic
1046736365 8:117780466-117780488 TAAAAAGTGGGCCAAGGGCCGGG + Intergenic
1047224708 8:122946531-122946553 TGAATAGTGGTAAAATGGCCTGG - Intronic
1047368110 8:124231036-124231058 CAAAAAGTGGGCAAATAGCTGGG - Intergenic
1047440359 8:124872174-124872196 AAAAAATTGTGCAAATGCCCAGG - Intergenic
1047753855 8:127903250-127903272 TAAAAAGTGGGCAAAGCACAAGG - Intergenic
1047898114 8:129389226-129389248 AGAAAGCTGGGCAAATGGCCAGG - Intergenic
1048186573 8:132247489-132247511 TAAAAACTGAGAATATGGCCGGG + Intronic
1048415313 8:134221752-134221774 CAAAAAGTGGGCAAATGACAGGG + Intergenic
1049606498 8:143531905-143531927 GAAAAAGAGGAGAAATGGCCCGG + Intronic
1049908863 9:245922-245944 TAAAAATTGGGCATCTGGCTGGG + Intronic
1049908913 9:246223-246245 AAAAAAATGGGCATCTGGCCAGG + Intronic
1050403973 9:5287771-5287793 TAAAAAGTGGGCAAAGGACATGG - Intergenic
1050579401 9:7035307-7035329 TTAAGAATGGGCAAATGGCCAGG - Intronic
1050641192 9:7669493-7669515 TAAAAACTGGGAAAATGCCATGG + Intergenic
1050670381 9:7989984-7990006 TAAAAAGTAGCCAAGTGGCCAGG - Intergenic
1050677075 9:8068340-8068362 TAAAAATTTGGCTAATGACCTGG - Intergenic
1050798702 9:9580842-9580864 TAAAAAGTAGGCTAAGGGCTGGG - Intronic
1051427213 9:16944675-16944697 TAAAAAATGGGCAAAGGGGCAGG + Intergenic
1052100633 9:24441846-24441868 TTAAAAATGAGCAAAGGGCCAGG - Intergenic
1052178216 9:25490859-25490881 TAAAAAGCTAGCAAATGGCCAGG - Intergenic
1052705236 9:31987367-31987389 TAAAAATCGGGCAAATGGGATGG + Intergenic
1052869047 9:33485617-33485639 TTAAAAGTGGGCAAAGGGTCAGG + Intergenic
1053116112 9:35504068-35504090 TAAAAAGTATTAAAATGGCCAGG - Intronic
1053145886 9:35711865-35711887 GAAAAGGTGGGCACATAGCCTGG + Intronic
1053188923 9:36043336-36043358 TAAAAAGTGGGCTAAGGAGCCGG - Intronic
1053436480 9:38078577-38078599 TAAAAAATGGGCAAAGGGCTGGG - Intergenic
1053506207 9:38645557-38645579 AAAAAAGTGAACAAAAGGCCAGG - Intergenic
1053572522 9:39324313-39324335 TAAAAAGTGTGATACTGGCCAGG - Intergenic
1053579398 9:39388156-39388178 TTAAAAGTGGGCAAAAGGCCGGG - Intergenic
1053605385 9:39653210-39653232 TAAAAAATGGGCAAAGGACATGG - Intergenic
1053843911 9:42216238-42216260 TTAAAAGTGGGCAAAAGGCCGGG - Intergenic
1053863302 9:42409837-42409859 TAAAAAATGGGCAAAGGACATGG - Intergenic
1054094081 9:60883026-60883048 TAAAAAGTGTGATACTGGCCAGG - Intergenic
1054100984 9:60946965-60946987 TTAAAAGTGGGCAAAAGGCCGGG - Intergenic
1054122361 9:61222339-61222361 TTAAAAGTGGGCAAAAGGCCGGG - Intergenic
1054124623 9:61294698-61294720 TAAAAAGTGTGATACTGGCCAGG + Intergenic
1054248157 9:62689206-62689228 TAAAAAATGGGCAAAGGACATGG + Intergenic
1054562272 9:66723731-66723753 TAAAAAATGGGCAAAGGACATGG + Intergenic
1054585367 9:66959918-66959940 TTAAAAGTGGGCAAAAGGCCGGG + Intergenic
1054592205 9:67023601-67023623 TAAAAAGTGTGATACTGGCCAGG + Intergenic
1055534086 9:77218406-77218428 TAAAAAGTGGGCAAAGGGCTGGG - Intronic
1055743759 9:79419505-79419527 TTAAAAATGGGCAAATAACCTGG - Intergenic
1055926203 9:81512342-81512364 TAAAAAGAGGGCAGGAGGCCAGG + Intergenic
1055969336 9:81896121-81896143 TAAAAAGTAGGCAAAGGACATGG + Intergenic
1056146557 9:83736843-83736865 TAAAGAGTGGGCAAAAGACATGG - Intergenic
1057155330 9:92833203-92833225 TAAAAAGTGGGCAAAGGAAAGGG + Intergenic
1057306148 9:93913102-93913124 TAAAAAGGGGGAAATTGGCCGGG + Intergenic
1057641044 9:96821957-96821979 TAAAAAGTGAACTATTGGCCAGG - Intronic
1057689350 9:97269446-97269468 TTAAAAGTGGGCAAAGGGTCAGG - Intergenic
1057708724 9:97417829-97417851 TAAAAAGGGGGTGAAAGGCCAGG + Intronic
1057924839 9:99136148-99136170 TAAAAAGTTAACAATTGGCCAGG - Intronic
1058199615 9:102023057-102023079 TAAAAAGTGGGCAAAGGACATGG - Intergenic
1058311842 9:103514056-103514078 TAAAAAGTGGGCAAAGGACATGG + Intergenic
1059477625 9:114560641-114560663 TTAAAAGTGCACAGATGGCCGGG + Intergenic
1059760591 9:117333797-117333819 TTTAAAATGGGCAAATGGACGGG - Intronic
1059936962 9:119321224-119321246 TAAAATGGGGACCAATGGCCGGG - Intronic
1060383360 9:123198431-123198453 TAAAAAGCAGGCAAAAGGCCGGG - Intronic
1060415868 9:123430016-123430038 TAAAAAGTGAGCAAAGGACATGG + Intronic
1060490991 9:124084019-124084041 GAAAAACTGGGCAAAGGGCCAGG - Intergenic
1060867469 9:127011471-127011493 TAAAAAATGGGCTCTTGGCCAGG - Intronic
1061357014 9:130113524-130113546 TAAGAACTGGGAAACTGGCCGGG - Intronic
1061691801 9:132339056-132339078 TAAAAATTGGGAAAAGGGCTGGG - Intronic
1061901561 9:133675045-133675067 TTAAAAATGGGCAAAGGGGCCGG + Intronic
1061930605 9:133831138-133831160 TGGAAAATGGGCAACTGGCCGGG + Intronic
1185829431 X:3285870-3285892 TAAAAAATGGGCAAACAGCCAGG - Intergenic
1187199171 X:17118252-17118274 TAAAAAGTCAGGAAACGGCCGGG - Intronic
1187326889 X:18299215-18299237 TAAAAAGTGGACAAAGGGGCTGG + Intronic
1187451983 X:19406156-19406178 TATAAAATGGGAAAATGGTCTGG + Intronic
1187700231 X:21957924-21957946 CAAAAAGTGGGCAAAGGACATGG - Intronic
1188027254 X:25223125-25223147 TAAAAAGTGGGCAAAGGACATGG - Intergenic
1188049137 X:25463198-25463220 TAAAAAGTGGGCAAAAGACATGG - Intergenic
1188272166 X:28153369-28153391 TAAAAAGTGGGCAAAGAGCCTGG + Intergenic
1188337870 X:28960711-28960733 GAAAATGTGGGTAAAGGGCCGGG + Intronic
1188485392 X:30676084-30676106 TAAAAATTAGCCAGATGGCCTGG - Intronic
1188711413 X:33405190-33405212 TAAAAAGTGGGCAAAGAACATGG - Intergenic
1188958199 X:36459657-36459679 TAAAAAGTGGGCAAAGGACATGG + Intergenic
1189167576 X:38875996-38876018 TAAAAAGTGGGCAAATGGCCGGG - Intergenic
1189422545 X:40869206-40869228 TAAAAAGTGGGTAAAAGGCCTGG - Intergenic
1190027822 X:46942036-46942058 TAAAAGGTGGACAAAAGGCCAGG - Intronic
1190375742 X:49786526-49786548 TAAAAAGTCAAGAAATGGCCAGG - Intergenic
1190517647 X:51241623-51241645 TAAAAAGTGGGCAAAGAAACTGG + Intergenic
1191138450 X:57091537-57091559 TAAAAAGAGGGCAAAGGACATGG + Intergenic
1191593362 X:62913447-62913469 TAAAAATTGGGGAAAAGTCCAGG - Intergenic
1191668429 X:63726633-63726655 TAAAATATAGGTAAATGGCCAGG - Intronic
1191738431 X:64411721-64411743 TAAAAAGTGGGCAAACAACAAGG - Intergenic
1191787235 X:64929186-64929208 CAAAAAGTGGGCAAAGGGGCAGG - Intronic
1191860494 X:65662960-65662982 TAAAAAATGAGCAAAGGGCCAGG + Intronic
1191910175 X:66141823-66141845 TAAAAAGTGGGCAAAAAACAAGG - Intergenic
1192045400 X:67666876-67666898 TAAAAAATGGGCAAAAGATCTGG - Intronic
1192242472 X:69344149-69344171 TCAAAAATGAGCAAAGGGCCGGG - Intergenic
1192364813 X:70462551-70462573 TAAAAAGTAATCAAGTGGCCGGG - Intronic
1192396682 X:70789037-70789059 TAAATAATGGGCAAAAAGCCAGG + Intronic
1192443463 X:71192488-71192510 TCAAAAGTAGGGGAATGGCCGGG - Intergenic
1192690856 X:73361991-73362013 AAAAAAGTGAGCTAAGGGCCGGG - Intergenic
1192737051 X:73859288-73859310 TAAAAAATGGGCACAGGACCTGG - Intergenic
1192821727 X:74653411-74653433 TAAAAAGTGGGCAAAGCGGGGGG - Intergenic
1192842179 X:74867955-74867977 TAAAAAGTGGGCAAAGAACATGG + Intronic
1192984192 X:76379399-76379421 TAAAATGTGGGTAAATGGGGTGG + Intergenic
1193020803 X:76790799-76790821 TAAAAAGTGGGCAAATTGGTTGG + Intergenic
1193054059 X:77131120-77131142 TAAAAACTGGGCAAAGGACATGG + Intergenic
1193072173 X:77317820-77317842 TAAAAAGTGGGCAAAGGATATGG + Intergenic
1193108894 X:77707446-77707468 TTAAAAATGGGCAAAGGGGCTGG + Intronic
1193133862 X:77948033-77948055 TAAATTGTGGTAAAATGGCCAGG - Intronic
1193160143 X:78218463-78218485 TAAAAAGTGAGCAAAGGACATGG - Intergenic
1193614821 X:83674083-83674105 CAAAAAGTGGGCAAAGGACATGG - Intergenic
1193849410 X:86517711-86517733 TAAAAAGCGGGCAAAGGGTCAGG - Intronic
1193864774 X:86718295-86718317 TACAAAGTGGGCAAAGGACATGG - Intronic
1193984542 X:88224031-88224053 CAAAAAGTGGGCAAAAGACATGG - Intergenic
1194013844 X:88595191-88595213 TAAAAAGTGGGCAAAAGTCATGG + Intergenic
1194072577 X:89345316-89345338 TAAAAAGTAGGCAAAAGACCTGG - Intergenic
1194123094 X:89984502-89984524 TAAAATTTGGGCAAAGGACCTGG - Intergenic
1194205480 X:91006145-91006167 TAAAAAGAGAGAAAATGGGCCGG - Intergenic
1194334649 X:92630190-92630212 TAAAGAGTGGGAAAATGTTCAGG - Intergenic
1194554490 X:95340289-95340311 TTAAACGTGGGCAAAGGGCAGGG + Intergenic
1194795026 X:98200674-98200696 TAAAAAGTGGGGATACGGCCGGG - Intergenic
1195056789 X:101153580-101153602 TAAAAAATGAGCAAAGGGCCAGG - Intronic
1195455574 X:105065478-105065500 TAAAAAGTGGGCAAGTTGTAGGG + Intronic
1195483325 X:105373333-105373355 TAAAAAGTGGGCAAAGGACATGG - Intronic
1195559632 X:106268936-106268958 TAAAGAGAGAGCCAATGGCCTGG + Intergenic
1195562329 X:106297403-106297425 TAAAGAGAGAGCCAATGGCCTGG - Intergenic
1195610211 X:106858224-106858246 AAAAAAGTGGGCAAAGGACATGG - Intronic
1195833825 X:109089719-109089741 TAAAAAGTGGGCAAAGCTGCTGG - Intergenic
1195971880 X:110482315-110482337 TAAAAAGTCAGGAAATGGCCGGG + Intergenic
1196080586 X:111626647-111626669 TAAAAAGTGGGCAAATGGACGGG + Intergenic
1196132448 X:112172035-112172057 TAAAAAATGGGCAAAAAGGCTGG + Intergenic
1197192267 X:123661107-123661129 AAAAAAGTGGCCTCATGGCCGGG + Intronic
1197256140 X:124265294-124265316 TAAAAAGTGGCCAAAGGACATGG - Intronic
1197327875 X:125116714-125116736 TAAAAAGTCAGCAAACGGCTGGG + Intergenic
1197437213 X:126445954-126445976 TAAAAAGTGGGCAAAGGACATGG - Intergenic
1197511772 X:127378520-127378542 TAAAAAGTGGGCAAATGATATGG + Intergenic
1197555895 X:127952780-127952802 CAAAAAATGGGCAAATGACTTGG - Intergenic
1197589467 X:128390534-128390556 TAAAAATTGTCCATATGGCCAGG - Intergenic
1197700617 X:129596863-129596885 ATAAAAGTGGGCTAATGGCCGGG - Intergenic
1197763069 X:130041073-130041095 TAAAAAATGGGAAATAGGCCAGG + Intronic
1198454468 X:136802313-136802335 AGAAAAATGGGCAAAAGGCCAGG - Intergenic
1198577987 X:138031793-138031815 TAAAAATTGGGCAAAGGACATGG + Intergenic
1198712507 X:139521038-139521060 TAAAAAGTGGGCAAAAGGCATGG - Intergenic
1198739303 X:139823979-139824001 TAAAAGCTGGGCAAAGGGCGGGG + Intronic
1199066326 X:143422810-143422832 TTAAAAATGGGCAAAAGGGCTGG - Intergenic
1199306599 X:146274200-146274222 TAAAAAGTGGACAAATGACATGG - Intergenic
1199418155 X:147611006-147611028 TTAAAAATGGGCAAAAGGCCTGG + Intergenic
1199587419 X:149430950-149430972 TTAAAAATGGGCAAATGGCTGGG + Intergenic
1199796914 X:151207494-151207516 TAAAAAGTAGACAAAGGGCTGGG - Intergenic
1199858834 X:151781459-151781481 TAAAAAGTGAGCTGCTGGCCCGG - Intergenic
1199912667 X:152304120-152304142 TAAAAAGTGGGCAAATAACATGG - Intronic
1200013062 X:153134758-153134780 TAAAACGTGGGCATATGACGTGG - Intergenic
1200026539 X:153265165-153265187 TAAAACGTGGGCATATGACGTGG + Intergenic
1200330892 X:155296665-155296687 TAAAATATGGGCAAAGGGCATGG + Intronic
1200386375 X:155894913-155894935 TAAAGAGTGAGCGAAAGGCCAGG - Intronic
1200406348 Y:2815424-2815446 TAAAAACTGGGCAAAGGGGTGGG - Intergenic
1200422826 Y:2989842-2989864 TAAAAAGTAAGCAAAGGGTCGGG - Intergenic
1200643129 Y:5747244-5747266 TAAAGAGTGGGAAAATGTTCAGG - Intergenic
1200726815 Y:6681062-6681084 TAAAAAGTAGGCAAAAGACCTGG - Intergenic
1200727967 Y:6696838-6696860 TAAAAAGTAGGCAAAAGACCTGG - Intergenic
1200813925 Y:7512499-7512521 TAAAAAGTCAGAAAATGGCCAGG + Intergenic
1201248566 Y:12032044-12032066 TAAAAAATAGGCAAACAGCCAGG + Intergenic
1201532001 Y:15001581-15001603 TAATAAGTAGAAAAATGGCCTGG + Intergenic