ID: 987351877

View in Genome Browser
Species Human (GRCh38)
Location 5:17029561-17029583
Sequence GGGCAAATGGCCGGGTGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987351867_987351877 0 Left 987351867 5:17029538-17029560 CCCCAACAATCCCATTAAAAAGT No data
Right 987351877 5:17029561-17029583 GGGCAAATGGCCGGGTGCGCTGG No data
987351868_987351877 -1 Left 987351868 5:17029539-17029561 CCCAACAATCCCATTAAAAAGTG 0: 15
1: 168
2: 469
3: 582
4: 1014
Right 987351877 5:17029561-17029583 GGGCAAATGGCCGGGTGCGCTGG No data
987351872_987351877 -10 Left 987351872 5:17029548-17029570 CCCATTAAAAAGTGGGCAAATGG 0: 13
1: 204
2: 2132
3: 10666
4: 13871
Right 987351877 5:17029561-17029583 GGGCAAATGGCCGGGTGCGCTGG No data
987351869_987351877 -2 Left 987351869 5:17029540-17029562 CCAACAATCCCATTAAAAAGTGG 0: 2
1: 31
2: 102
3: 146
4: 370
Right 987351877 5:17029561-17029583 GGGCAAATGGCCGGGTGCGCTGG No data
987351866_987351877 1 Left 987351866 5:17029537-17029559 CCCCCAACAATCCCATTAAAAAG No data
Right 987351877 5:17029561-17029583 GGGCAAATGGCCGGGTGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987351877 Original CRISPR GGGCAAATGGCCGGGTGCGC TGG Intergenic
No off target data available for this crispr