ID: 987351879

View in Genome Browser
Species Human (GRCh38)
Location 5:17029588-17029610
Sequence CGCCTGTAATCCCAGCACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 988408
Summary {0: 121435, 1: 268139, 2: 223994, 3: 153979, 4: 220861}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987351872_987351879 17 Left 987351872 5:17029548-17029570 CCCATTAAAAAGTGGGCAAATGG 0: 13
1: 204
2: 2132
3: 10666
4: 13871
Right 987351879 5:17029588-17029610 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
987351868_987351879 26 Left 987351868 5:17029539-17029561 CCCAACAATCCCATTAAAAAGTG 0: 15
1: 168
2: 469
3: 582
4: 1014
Right 987351879 5:17029588-17029610 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
987351866_987351879 28 Left 987351866 5:17029537-17029559 CCCCCAACAATCCCATTAAAAAG No data
Right 987351879 5:17029588-17029610 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
987351869_987351879 25 Left 987351869 5:17029540-17029562 CCAACAATCCCATTAAAAAGTGG 0: 2
1: 31
2: 102
3: 146
4: 370
Right 987351879 5:17029588-17029610 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
987351867_987351879 27 Left 987351867 5:17029538-17029560 CCCCAACAATCCCATTAAAAAGT No data
Right 987351879 5:17029588-17029610 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
987351878_987351879 -6 Left 987351878 5:17029571-17029593 CCGGGTGCGCTGGCTCACGCCTG 0: 46
1: 8473
2: 55541
3: 109915
4: 146824
Right 987351879 5:17029588-17029610 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
987351874_987351879 16 Left 987351874 5:17029549-17029571 CCATTAAAAAGTGGGCAAATGGC No data
Right 987351879 5:17029588-17029610 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987351879 Original CRISPR CGCCTGTAATCCCAGCACTT TGG Intergenic
Too many off-targets to display for this crispr