ID: 987355756

View in Genome Browser
Species Human (GRCh38)
Location 5:17061979-17062001
Sequence CAGTCCCATGATTCTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987355756_987355760 20 Left 987355756 5:17061979-17062001 CCTCCCACAGAATCATGGGACTG No data
Right 987355760 5:17062022-17062044 CTGCTCTCCCTCATAGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987355756 Original CRISPR CAGTCCCATGATTCTGTGGG AGG (reversed) Intergenic
No off target data available for this crispr