ID: 987356425

View in Genome Browser
Species Human (GRCh38)
Location 5:17067162-17067184
Sequence ATGTGCAATACGAAGGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987356419_987356425 -3 Left 987356419 5:17067142-17067164 CCTTTCCCAAATACCAGTATATG 0: 1
1: 0
2: 0
3: 12
4: 190
Right 987356425 5:17067162-17067184 ATGTGCAATACGAAGGTGGTAGG No data
987356417_987356425 5 Left 987356417 5:17067134-17067156 CCTCCTTTCCTTTCCCAAATACC 0: 1
1: 0
2: 1
3: 61
4: 560
Right 987356425 5:17067162-17067184 ATGTGCAATACGAAGGTGGTAGG No data
987356418_987356425 2 Left 987356418 5:17067137-17067159 CCTTTCCTTTCCCAAATACCAGT 0: 1
1: 0
2: 11
3: 57
4: 359
Right 987356425 5:17067162-17067184 ATGTGCAATACGAAGGTGGTAGG No data
987356420_987356425 -8 Left 987356420 5:17067147-17067169 CCCAAATACCAGTATATGTGCAA 0: 1
1: 0
2: 0
3: 18
4: 172
Right 987356425 5:17067162-17067184 ATGTGCAATACGAAGGTGGTAGG No data
987356421_987356425 -9 Left 987356421 5:17067148-17067170 CCAAATACCAGTATATGTGCAAT 0: 1
1: 0
2: 1
3: 14
4: 149
Right 987356425 5:17067162-17067184 ATGTGCAATACGAAGGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987356425 Original CRISPR ATGTGCAATACGAAGGTGGT AGG Intronic
No off target data available for this crispr