ID: 987359188

View in Genome Browser
Species Human (GRCh38)
Location 5:17091582-17091604
Sequence CCTGCTTTACAGTCGGTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 65}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987359188_987359192 12 Left 987359188 5:17091582-17091604 CCCTGGACCGACTGTAAAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 65
Right 987359192 5:17091617-17091639 TTATTTCTAGCTGCAAAACGAGG 0: 1
1: 0
2: 1
3: 12
4: 161
987359188_987359193 21 Left 987359188 5:17091582-17091604 CCCTGGACCGACTGTAAAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 65
Right 987359193 5:17091626-17091648 GCTGCAAAACGAGGAAGCTTAGG 0: 1
1: 0
2: 0
3: 7
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987359188 Original CRISPR CCTGCTTTACAGTCGGTCCA GGG (reversed) Intronic
900394492 1:2447599-2447621 CCTGCCTTCCAGTCTCTCCAGGG - Intronic
902799203 1:18819029-18819051 CCTGCTTTAGGGTGGGGCCAAGG + Intergenic
904296990 1:29526223-29526245 CCTCCTGTACATTCTGTCCAGGG - Intergenic
904319767 1:29689345-29689367 CTAGCTTCACAGTAGGTCCAGGG - Intergenic
906689745 1:47784775-47784797 CCTGCTTTGCAGGCCGCCCAGGG + Intronic
911017630 1:93351313-93351335 ACTGCTTTCAAGTAGGTCCAAGG - Intronic
911183857 1:94884396-94884418 CCAGTTTTACTGTAGGTCCAAGG + Intronic
913233699 1:116762839-116762861 CCTGCTCTCCAGTTTGTCCAGGG - Intronic
915124686 1:153655606-153655628 CCTGCTTCACAGTCAGGCCTTGG - Intergenic
920720177 1:208379880-208379902 CCTGATTTATAGCCGGTCAATGG + Intergenic
921939560 1:220826243-220826265 CCTTCTTTGCAGTCTGTCCCTGG + Intergenic
924862735 1:247942386-247942408 CCTGAATTCCAGTGGGTCCACGG + Intronic
1065169676 10:23013995-23014017 ACTCCTTTACAGTATGTCCAGGG + Intronic
1077387640 11:2278383-2278405 CCTGCTGTATACTCTGTCCACGG - Intergenic
1079455272 11:20630940-20630962 CCTTCTTTACAGAGGGACCAAGG + Intronic
1081995618 11:47361827-47361849 CCTGCTTTGCAGTATGACCATGG + Intronic
1083110881 11:60405381-60405403 CCTGAGTTACAGTGAGTCCAAGG - Intronic
1084791934 11:71480675-71480697 CCTGCTTGTCTGTCGGTCCTGGG + Intronic
1086288426 11:85276003-85276025 CCTGCCTTAGACTCCGTCCATGG - Intronic
1086833957 11:91599171-91599193 CCTGACTTACAGTGGGTCCAGGG + Intergenic
1090760044 11:129828446-129828468 CCTGCTCTACAGTGGGCTCAGGG - Intronic
1101200118 12:102427005-102427027 CCTGGTTTTCAGTCATTCCAGGG - Intronic
1104809798 12:131613218-131613240 CCTGGGTTACAGAGGGTCCAGGG - Intergenic
1109951183 13:69503435-69503457 TCTGAGTTACAGTGGGTCCAGGG - Intergenic
1110763123 13:79252445-79252467 CCTGCTTTACAGTGGGGCAAGGG + Intergenic
1111265963 13:85813751-85813773 TCTGCTTTACATTTGGACCAAGG + Intergenic
1112231293 13:97591378-97591400 TCTGACTTACAGTGGGTCCACGG - Intergenic
1112428985 13:99332891-99332913 CCTGCTTTTCAGAGGGTCTATGG + Intronic
1115460357 14:33653182-33653204 GCTGCTTTAAAGTAGGTCCCTGG + Intronic
1115799669 14:36978810-36978832 CCTGATTTAGAGTCGGTGAATGG - Intronic
1124533309 15:30524133-30524155 TCTGCTTAACAGTCAGCCCATGG - Intergenic
1124765348 15:32483512-32483534 TCTGCTTAACAGTCAGCCCATGG + Intergenic
1129886758 15:79043630-79043652 CCTTCTTTACAATGGGTCCAAGG - Intronic
1130433174 15:83869554-83869576 CCTGTTATGCAGTCTGTCCAGGG + Intronic
1142249095 16:88983002-88983024 GCTGCTTTCCTGTGGGTCCAAGG - Intergenic
1149076531 17:52602066-52602088 CCTGCTATGCAGCCTGTCCATGG + Intergenic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1158615154 18:58980351-58980373 ACTGCTTTACAGTGAGTTCATGG - Intronic
1166564730 19:43756840-43756862 CCTGGTACACAGTGGGTCCAAGG - Intergenic
925640475 2:5981775-5981797 CCTGCTTTACCGACGGTCCCGGG - Intergenic
932208476 2:69906350-69906372 GCTGCTTTATAGTCAATCCATGG + Intronic
932398204 2:71462546-71462568 CCTGCTGTTCAGTGGGTCCTGGG + Intronic
935527461 2:104188321-104188343 CCTGCTTTTCAGTTGGTTCAAGG + Intergenic
1177832574 21:26155499-26155521 TCTGCTTTAAAGTCAGTCCTGGG + Intronic
1181627620 22:24132399-24132421 CCTGCTCCACAGCAGGTCCAAGG - Intronic
1183279149 22:36922904-36922926 CAGGCTGCACAGTCGGTCCAGGG + Intronic
953379720 3:42459859-42459881 CCTGTTTCACAGTAAGTCCAAGG + Intergenic
956398243 3:68848523-68848545 CCTACTTTACAGCCTTTCCAGGG + Intronic
966742605 3:183248471-183248493 CCTGCTTTACAGAGAGTACACGG - Intronic
969175281 4:5394090-5394112 CCTGCTTTGCAGTCTGTGCATGG + Intronic
974649450 4:64735201-64735223 CCTGCTTTATAGTAGGGACAAGG - Intergenic
975261778 4:72311146-72311168 CCACCTTTACTGTCAGTCCAAGG - Exonic
983333297 4:166359271-166359293 CCTGCTGTTCAGTGGGTCCCAGG + Intergenic
985812921 5:2103367-2103389 CCTGCTTCACAGTCCTTCCGGGG + Intergenic
987359188 5:17091582-17091604 CCTGCTTTACAGTCGGTCCAGGG - Intronic
995396203 5:111689654-111689676 CCTGCTTTACAGTCATACCTGGG + Intronic
997908064 5:137840252-137840274 CCTGCTTTACAGACTGTCCCTGG - Intergenic
1007677998 6:43614081-43614103 AATGCTTTACAGTTGGACCATGG - Exonic
1008820239 6:55623915-55623937 TCTGACTTACAGTCGGTCCCTGG - Intergenic
1018470555 6:164093404-164093426 CCTTCTTTACATTTGGTGCAAGG + Intergenic
1019173378 6:170147273-170147295 CTTGCTTTACAGTGAGGCCAAGG + Intergenic
1029734082 7:102455915-102455937 GCTGCTTTACAGACAGTGCACGG + Exonic
1032736336 7:134695874-134695896 GCTGCTTTACAGTGTGGCCACGG + Intergenic
1033866889 7:145700063-145700085 ACTGCCTTAGAGTCAGTCCAGGG + Intergenic
1039971485 8:42324837-42324859 CCTGCCATACTTTCGGTCCAGGG + Intronic
1041912657 8:63105210-63105232 GCTGCCTTAAATTCGGTCCAAGG + Intergenic
1052897608 9:33762356-33762378 CCTGCTCTACAGTGGGCTCAGGG - Intronic
1053141844 9:35687515-35687537 CCTGCCCTACAGTCCGACCAAGG - Intronic
1057404915 9:94760712-94760734 CCTGCTTCACTGTAGGTCTAAGG - Intronic
1062702557 9:137915057-137915079 CCTGCTTTACAGAGGGGCCCAGG + Intronic
1185777303 X:2814057-2814079 CCTGCTTTACATTCGGCAGAAGG - Intronic
1187295218 X:17992751-17992773 CATGTTTTACAGTGGGTCCATGG + Intergenic
1194486504 X:94492881-94492903 CCAGCTTTGCAGGCGGCCCACGG + Intergenic
1194910205 X:99631970-99631992 CCTCCTGTACAGTCAGTCTATGG - Intergenic