ID: 987363920

View in Genome Browser
Species Human (GRCh38)
Location 5:17131287-17131309
Sequence GAAAAAGCATAGTTGCTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987363913_987363920 23 Left 987363913 5:17131241-17131263 CCATCTCAGACTCTGGAGGCAGG 0: 1
1: 0
2: 3
3: 34
4: 717
Right 987363920 5:17131287-17131309 GAAAAAGCATAGTTGCTGCTAGG 0: 1
1: 0
2: 0
3: 19
4: 201
987363910_987363920 30 Left 987363910 5:17131234-17131256 CCTTTCTCCATCTCAGACTCTGG 0: 1
1: 0
2: 3
3: 72
4: 541
Right 987363920 5:17131287-17131309 GAAAAAGCATAGTTGCTGCTAGG 0: 1
1: 0
2: 0
3: 19
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987363920 Original CRISPR GAAAAAGCATAGTTGCTGCT AGG Intronic
901710681 1:11112418-11112440 TAAAAAACATATTAGCTGCTTGG + Intronic
905045766 1:34999427-34999449 GAAAAGGGATAGTTGCTGGAGGG + Intronic
906193562 1:43914703-43914725 GAGAAAGCACAGGGGCTGCTCGG - Intronic
907681053 1:56564102-56564124 GAAAGAGCATAGGTGTTGGTTGG + Intronic
908688935 1:66754966-66754988 GAAATAGCAAAAATGCTGCTAGG - Intronic
909113097 1:71504330-71504352 CAAAAATCATAGTTTCTACTGGG + Intronic
909222101 1:72978434-72978456 GAGAAAGCACAGTTGCAGATTGG + Intergenic
913168537 1:116211453-116211475 GAAAAAGGAAAGTTGGTGCTGGG - Intergenic
913429443 1:118774663-118774685 GAAGTAGAATGGTTGCTGCTGGG - Intergenic
914397334 1:147282525-147282547 GAAAATGCAAAGTTGCTGGAGGG - Intronic
917648199 1:177049060-177049082 AGAAAAGCAGAGTTGCTGCAGGG + Intronic
918429693 1:184446357-184446379 GACAAATCATACTTGCCGCTTGG - Intronic
921861885 1:220049329-220049351 AAAAAAGAATAGTGTCTGCTAGG + Intergenic
922332383 1:224588566-224588588 GAACCAGCATAGTTTCTGGTAGG + Intronic
924206323 1:241714790-241714812 GAAAAATCAGAGTTGGTGATTGG - Intronic
1065007180 10:21390796-21390818 GAAAAATCAGTGTTGCTCCTGGG + Intergenic
1069298440 10:66876708-66876730 GAAAGAGTATGGTTGCTGCCAGG + Intronic
1069485493 10:68820005-68820027 TAATAAGCATAGTAGCTGATGGG + Intergenic
1070171104 10:73933216-73933238 TAAAATGCATAGTTGGGGCTAGG + Intergenic
1070342446 10:75510380-75510402 AGAAAAGCATAGATGCTGTTGGG + Intronic
1071716255 10:88099204-88099226 GAAAAATAATATTTGCTACTGGG - Intergenic
1073212408 10:101815889-101815911 GAAATACTATAGTTACTGCTAGG - Intronic
1073614842 10:104983299-104983321 GAAAAAGCATGCTTGGGGCTGGG - Intronic
1073634882 10:105187531-105187553 GAAAGAGCATAGTTGTGGCAAGG - Intronic
1075458526 10:122600539-122600561 GAAAAGGCAGAGTTTGTGCTTGG + Intronic
1079010649 11:16825471-16825493 GACAAAGCACAGTGGCTTCTGGG + Intronic
1080056788 11:27915073-27915095 GAAATAGCAGAGTCACTGCTTGG + Intergenic
1080696496 11:34607262-34607284 AAAAATTAATAGTTGCTGCTAGG - Intergenic
1080738596 11:35042212-35042234 GAGAAAGGATTGTAGCTGCTTGG + Intergenic
1081307075 11:41526082-41526104 TAAAAAGCATAGTACCTGATAGG + Intergenic
1082085856 11:48048987-48049009 CAGAGAGCACAGTTGCTGCTTGG + Intronic
1083616710 11:64029833-64029855 CAAAAAGCATATTCTCTGCTGGG + Intronic
1086010495 11:82097415-82097437 AAAGAAGCAGAGTTTCTGCTTGG + Intergenic
1087900782 11:103638104-103638126 TAAAATGCATAGTTCCTGCTTGG + Intergenic
1090958275 11:131533515-131533537 GGAAAAGCAAAGTAGCTGCTTGG + Intronic
1091792712 12:3280903-3280925 GAAAGAGCAGAGGTGCTGGTGGG + Intronic
1093033584 12:14312031-14312053 AAAAAAACATAGTTGCCACTTGG - Intergenic
1094318079 12:29153963-29153985 GGAAAAGTATACTGGCTGCTGGG + Intronic
1095641120 12:44486154-44486176 GAAATAGCAGAGTTGTTTCTAGG + Intergenic
1095833347 12:46610901-46610923 GAAAAAGCACAGTGCGTGCTGGG + Intergenic
1097295760 12:57960750-57960772 GATAAAGCAAAGGTGGTGCTAGG + Intergenic
1097553489 12:61106266-61106288 TAATAAGCATAGTTCCTGATAGG - Intergenic
1099883882 12:88502970-88502992 GAAAAAGCATGGTTTCAGCTTGG + Intronic
1103616184 12:122154112-122154134 AAAAAAAAAAAGTTGCTGCTGGG - Intergenic
1109063183 13:57647392-57647414 TGAAAAGCATATTTTCTGCTGGG - Intronic
1109843475 13:67951739-67951761 GGAAGAGCAGACTTGCTGCTGGG - Intergenic
1111570945 13:90085600-90085622 AGAAGAGCATAGATGCTGCTAGG + Intergenic
1111636314 13:90908299-90908321 GAAAAAGAATATTTGCTCCAGGG - Intergenic
1111734658 13:92122520-92122542 GAAAAAGCATATATGATGGTTGG - Intronic
1114137734 14:19871104-19871126 GAAAAAGACCAGCTGCTGCTTGG + Intergenic
1115536833 14:34381267-34381289 TAATAAGCATAGTCGCTGATAGG + Intronic
1115673912 14:35647980-35648002 GATAAAGCATATTTGAGGCTGGG + Intronic
1115878082 14:37882934-37882956 GAAAAAGATTAGTGGTTGCTAGG - Intronic
1117097062 14:52309746-52309768 TAAAAACCATGGCTGCTGCTTGG - Intergenic
1117895554 14:60482157-60482179 GTAAAAGCTTAATTTCTGCTAGG - Intronic
1117966690 14:61213725-61213747 GAAATAGCAGAGCAGCTGCTGGG - Intronic
1118496797 14:66315409-66315431 AAAATACCATAGTAGCTGCTTGG - Intergenic
1119253807 14:73181142-73181164 TAAAAATCATAGTTTCAGCTGGG + Intronic
1119362023 14:74058787-74058809 CAAAAAGCATAGAGGCGGCTGGG + Exonic
1119363464 14:74071261-74071283 CAAGAAGCATAGTTGCTCCAGGG + Exonic
1120811407 14:88807499-88807521 GAACAAGCATACATGCTGATTGG + Intergenic
1123673750 15:22687991-22688013 GAAAAAGCATATATGATGGTTGG - Intergenic
1124325753 15:28760982-28761004 GAAAAAGCATATATGATGGTTGG - Intergenic
1126233927 15:46359782-46359804 TAATAAGCATAGTACCTGCTAGG - Intergenic
1129910693 15:79223535-79223557 GAAAAAGCATAGCTCCTAGTGGG + Intergenic
1130756101 15:86765242-86765264 GAAAAAGCATATTTTTTGCAAGG - Intronic
1131374942 15:91915748-91915770 GAAAAAACATTGTTGCTACTGGG + Intronic
1131450827 15:92538387-92538409 GATAAAGCATAGATGCTGTTAGG + Intergenic
1132042726 15:98538548-98538570 AGCCAAGCATAGTTGCTGCTGGG - Intergenic
1132315280 15:100885793-100885815 GAAAAAAAATAGTTGCTACCCGG + Intronic
1135417767 16:22281654-22281676 CAAAAAGTATAGTGGCTGCTAGG - Intronic
1135996707 16:27255173-27255195 TAAAAAGCATAGTAGCGGCTGGG - Intronic
1137366829 16:47866850-47866872 GAAAAAGCAAATTTGTTTCTGGG + Intergenic
1141764046 16:86047038-86047060 GAGAAAGCAGAGTGGCTGCTGGG + Intergenic
1142541264 17:661224-661246 GAAAAAAAAAAGTTGCAGCTGGG + Intronic
1143104393 17:4521362-4521384 GAAAAAGAATTTTTCCTGCTGGG - Intronic
1145415715 17:22712136-22712158 GAAAAGGCAGAGTTGAAGCTGGG - Intergenic
1149862443 17:60129962-60129984 TAAAAAGCATAGTATCTGATAGG - Intergenic
1150123241 17:62620275-62620297 GAAAAAGCATATTTATTGTTTGG + Intergenic
1150572385 17:66398429-66398451 GAAAAATCAAAGTTGGTGATGGG + Intronic
1153463234 18:5360592-5360614 GAAAATTTATAGTTGCTGGTTGG + Intergenic
1157497731 18:48168242-48168264 GAAAAGGCTTACTTGCTGCAAGG + Intronic
1158196776 18:54896101-54896123 GAAACAGCATTATTGCTACTGGG - Intergenic
1159310489 18:66701588-66701610 GAAAAAGCATTGTAACTGCCAGG - Intergenic
1160319645 18:77878362-77878384 CAATAAGCATAGTCCCTGCTCGG + Intergenic
1160420407 18:78740143-78740165 GAAAAGGAATACTGGCTGCTGGG - Intergenic
1164573132 19:29388288-29388310 TGAAAAGCATAGCTTCTGCTGGG + Intergenic
1164870381 19:31638610-31638632 TAAAAAGCTTAGGTGCTGGTGGG + Intergenic
1165200763 19:34142557-34142579 GAAAAAGCATGGTAACTTCTGGG + Intergenic
1165582515 19:36880033-36880055 GAATAAGAATATTTGCTGCCAGG + Intronic
927372070 2:22367638-22367660 GAAAAAGCCTCGTTTCTGATGGG + Intergenic
930417429 2:51106296-51106318 GAAGAAGGATAGTAGCTGTTGGG + Intergenic
930901107 2:56508686-56508708 GAAACTGGATTGTTGCTGCTGGG - Intergenic
931659076 2:64540825-64540847 GAAACAAGATATTTGCTGCTTGG + Intronic
932033483 2:68215170-68215192 TAATAAGCATAGTAGCTGATAGG - Intronic
932839355 2:75067383-75067405 GAGGCTGCATAGTTGCTGCTAGG + Intronic
932913308 2:75828371-75828393 GAATAAGCATAGTACCTGATAGG - Intergenic
933299246 2:80524051-80524073 ACAAAAGCATAGCTGCTGATGGG + Intronic
935734588 2:106096731-106096753 AAAAAAGCAAAGCTGATGCTGGG - Exonic
935814150 2:106830762-106830784 GAAATTGTATCGTTGCTGCTTGG + Intronic
937591944 2:123624911-123624933 AAAAAAGGATAGATGCTGGTTGG + Intergenic
939389471 2:141547666-141547688 GAAAAAGCATGCCTGCTGCACGG - Intronic
942770390 2:179511095-179511117 GAAAAAACATAGCTGCTGCAGGG + Intronic
945694004 2:213079755-213079777 GAAAAATGGAAGTTGCTGCTAGG - Intronic
945955466 2:216082155-216082177 GAAAAAGAAAGGCTGCTGCTCGG + Exonic
946610221 2:221449730-221449752 GTAAAAGCATGGTTTATGCTGGG - Intronic
947991758 2:234493955-234493977 GAAAAAGCAGATGGGCTGCTAGG + Exonic
1169788865 20:9388421-9388443 TCAAAAACATAGGTGCTGCTGGG + Intronic
1170778770 20:19404641-19404663 GATACAGCATGGTTGCTGATGGG + Intronic
1171083835 20:22217557-22217579 TAAAAATCAGGGTTGCTGCTTGG + Intergenic
1171304367 20:24092521-24092543 CAAAAAGCGTTCTTGCTGCTAGG - Intergenic
1173152333 20:40578294-40578316 GGAAAAGCATTTGTGCTGCTGGG + Intergenic
1175363270 20:58431878-58431900 GAAAAAGGAGACGTGCTGCTTGG + Intronic
1175506070 20:59485220-59485242 GAAGAAGCACAGCAGCTGCTCGG + Intergenic
1175614260 20:60379756-60379778 TAAAAAGGATAGTAGATGCTGGG + Intergenic
1175664452 20:60846205-60846227 GAAAAAGGGTAGTAGCTGTTTGG - Intergenic
1176724058 21:10415183-10415205 TAAAAAGAAGAGTTGCAGCTGGG - Intergenic
1177269411 21:18827172-18827194 CAAAAAGCATATTAGATGCTGGG - Intergenic
1182253458 22:29020554-29020576 GAAAAAGGATGGTTGCGGCCAGG - Intronic
1184061289 22:42083531-42083553 GAAAATGCACAGTTTCTGTTGGG - Exonic
1184722322 22:46322230-46322252 GCAACAGCACAGCTGCTGCTGGG - Intronic
1185026769 22:48418644-48418666 GAAAAACCATAGTATCTGTTTGG + Intergenic
949942261 3:9163970-9163992 AAAAAAGAATAGTAGTTGCTGGG - Intronic
951860023 3:27241819-27241841 GGAAGAGCAAAGTTGCAGCTGGG + Intronic
955522187 3:59785612-59785634 GAAAAAGGAAAGATGCTGCCAGG - Intronic
956960241 3:74391156-74391178 GAGAAAGCATAGATGATCCTGGG - Intronic
959135246 3:102410711-102410733 GAAACAGGAGAGTTGCTGTTTGG + Intronic
960747909 3:120909281-120909303 GATAAAGCGTAGTTACAGCTGGG + Intronic
962333973 3:134509176-134509198 GTAGAAACATAGTTGCTTCTGGG + Intronic
962814599 3:138987088-138987110 GACAAAGAATCATTGCTGCTTGG + Intergenic
962931538 3:140042215-140042237 GAAAAAGGAAAGTTGCTGATGGG - Intronic
963360103 3:144261226-144261248 GAAAAAGCATTGGTGCTTATTGG + Intergenic
964420724 3:156499934-156499956 GAGAAAGCAGGGTGGCTGCTGGG - Intronic
965023257 3:163263419-163263441 GAATGAGCATAGTTCCTGATAGG + Intergenic
965065831 3:163847406-163847428 TAATAAGCATAGTATCTGCTAGG - Intergenic
971451948 4:26808811-26808833 GAAATAGCTTAGTTGGTACTTGG - Intergenic
973807863 4:54542957-54542979 GAAAAAGCAGAGCTGCCTCTAGG + Intergenic
974891799 4:67892547-67892569 GAAATTGCATGGTTGCTACTTGG + Intergenic
976192387 4:82500559-82500581 GCAAAAGCTTAATTGCTTCTTGG + Intronic
976860354 4:89658301-89658323 GAAGAAGCATACTTGCTTCTGGG + Intergenic
978307497 4:107347779-107347801 CAAAAAGTTTAGTTGCTGTTTGG - Intergenic
979883244 4:125988797-125988819 TAAAAAACATAGTTGCTGATAGG + Intergenic
981746840 4:148060536-148060558 GAACCAGCACAGTAGCTGCTTGG - Intronic
983388547 4:167098859-167098881 AAAAAGGCATAGTTTCTTCTGGG - Intronic
987363920 5:17131287-17131309 GAAAAAGCATAGTTGCTGCTAGG + Intronic
991931532 5:71757579-71757601 GCAAGAGGGTAGTTGCTGCTTGG + Intergenic
994011759 5:94912491-94912513 GAAAACACATAGTTGATGCCTGG - Intronic
994308969 5:98244051-98244073 CAAAAATCAAAGTAGCTGCTGGG - Intergenic
995061861 5:107819812-107819834 GTAAAAGCATTGATGGTGCTGGG + Intergenic
995645645 5:114308067-114308089 GGAAAAACATAGTTTCTTCTCGG - Intergenic
996266810 5:121550903-121550925 GAAAACTCCTAGTTACTGCTGGG - Intergenic
999429487 5:151513632-151513654 GAATAAGCATAGTTCCTGATAGG - Intronic
1000245259 5:159443746-159443768 GAAAAAGCAGAGAAGCTACTAGG - Intergenic
1001794448 5:174490406-174490428 GAAAAAGCATGTGTGCTGCTCGG + Intergenic
1003102010 6:3183839-3183861 GAAAAAGCATGCCTGCTGGTTGG - Intergenic
1003729765 6:8808348-8808370 TAAAAAATATAATTGCTGCTGGG + Intergenic
1004652728 6:17626881-17626903 CAAAAGGCATACTTGTTGCTGGG - Intronic
1006331597 6:33395229-33395251 GAAAAAGGATAGTACCTGTTAGG + Intronic
1007287880 6:40761260-40761282 GAAAAAGCATGGTGGAAGCTAGG + Intergenic
1008205391 6:48649868-48649890 TAACAAGCATAGTAGCTGATGGG - Intergenic
1010178758 6:73059450-73059472 TAAAAAGCATAGTACCTGATAGG - Intronic
1010619981 6:78062191-78062213 GAAGAAATCTAGTTGCTGCTGGG + Intergenic
1011562320 6:88633022-88633044 ACCAAAGCATAGTTGATGCTTGG + Intronic
1012879826 6:104774000-104774022 GAAAATGCTTAGTTGGTGCCTGG - Intronic
1014925924 6:127269624-127269646 GAAAAAGCATAGGTCATACTTGG - Intronic
1014962596 6:127705563-127705585 GAGAAAGCATAGATTCTTCTTGG - Intergenic
1015798928 6:137041679-137041701 TAATAAGCATAGTTGTTGTTTGG + Intronic
1017071313 6:150577471-150577493 GAAAATGCATACTTGTGGCTGGG + Intergenic
1017208348 6:151827573-151827595 GAAACATCATAGTTGAAGCTGGG - Intronic
1020436432 7:8167516-8167538 AAATAAGCATAGTAGCTGATAGG - Intronic
1027659599 7:80973309-80973331 GGAAAAAGATAGTTGTTGCTGGG + Intergenic
1029522315 7:101071058-101071080 GAAAAACCATAATTTCTGCCAGG - Intergenic
1030136851 7:106260487-106260509 GAAACAGCTTTATTGCTGCTAGG - Intronic
1030312016 7:108078517-108078539 GAAAAAGCATTGTTTCTCATGGG + Intronic
1030575022 7:111274991-111275013 GAAGAAGCAGAGTTGCGCCTTGG - Intronic
1030870317 7:114747582-114747604 GAAAAAGAATTGCTGCTTCTGGG - Intergenic
1034658108 7:152745360-152745382 GAGAAAGGATAGCTGCTGCCAGG + Intergenic
1034700377 7:153090241-153090263 GAAAAGGGAAAGTTACTGCTGGG - Intergenic
1036279512 8:7388048-7388070 TAACAAATATAGTTGCTGCTTGG - Intergenic
1037874978 8:22539612-22539634 GAAAAGGTATAGTTGTTTCTAGG + Intronic
1037900114 8:22683227-22683249 GAAAAACCAGAGTAGCTGCCAGG + Intergenic
1039988946 8:42471349-42471371 GAATAAGCAGAGTGGCTGGTTGG - Intronic
1040486960 8:47882782-47882804 GGAAAAGCATTGTTTCTACTTGG - Intronic
1043135143 8:76513579-76513601 GAAACAGCATAGTTGCAGATTGG + Intergenic
1043162693 8:76865660-76865682 GAAAAGGTATATTTGCTTCTCGG + Exonic
1044317744 8:90769424-90769446 GAAAAACCATATTTTATGCTTGG + Intronic
1045953390 8:107877948-107877970 AAAAAAATATAGTTGATGCTGGG + Intergenic
1047658799 8:127009686-127009708 CAAAAAGCATCGTGGCTGTTGGG + Intergenic
1049113291 8:140663624-140663646 CAAAAATGATAGTTGTTGCTGGG + Intronic
1049351584 8:142167488-142167510 GAAACAGCATAGTTGGTTCTGGG - Intergenic
1049618310 8:143586155-143586177 GAAAAATCAGACATGCTGCTTGG + Intronic
1052381454 9:27775365-27775387 GAAAAAGCAAAGATGCTGTTTGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053428090 9:38024270-38024292 AAAAACGGATAGTGGCTGCTGGG - Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053566259 9:39255772-39255794 GAAATAGAATAGTTGTTGCCAGG - Intronic
1054130890 9:61363241-61363263 GAAATAGAATAGTTGTTGCCAGG + Intergenic
1055602596 9:77935283-77935305 CAAAAACCATAGTACCTGCTGGG + Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058581496 9:106463473-106463495 GCAAAAGTAGAGTTGCTCCTGGG + Intergenic
1059088010 9:111325483-111325505 GAAGAAACATAGTTACTTCTAGG + Intergenic
1059671700 9:116498060-116498082 GAAAAAGCATAGTATCTGGCAGG + Intronic
1060227828 9:121806483-121806505 AAAAAAGCTTACCTGCTGCTTGG + Intergenic
1186545750 X:10447683-10447705 GAAAAAGGAGAGTGTCTGCTAGG + Exonic
1187722482 X:22165644-22165666 GAAAAAACATAGATGCTGGAGGG + Intronic
1188030789 X:25261243-25261265 GAAGAAACAGAGTTCCTGCTTGG + Intergenic
1188036876 X:25328605-25328627 GGAAATGCATAGGTGCTACTTGG + Intergenic
1188362306 X:29270964-29270986 TAATAAGCATAGTAGCTGATAGG + Intronic
1188712320 X:33415835-33415857 GTACAAGCATAAATGCTGCTTGG - Intergenic
1191739610 X:64422925-64422947 GAAAAGGCAGAATTTCTGCTGGG - Intergenic
1191845682 X:65545980-65546002 GGAAAAGCAAACTTGCTTCTGGG - Intergenic
1192054912 X:67763474-67763496 GTAAAATCATAGTTGATGCTTGG - Intergenic
1192852683 X:74974226-74974248 TAATAAGCATAGTTCCTGATAGG - Intergenic
1195155695 X:102121772-102121794 TAATAAGCATAGTAGCTGATAGG - Intergenic
1196120247 X:112042394-112042416 GAAAAAGCATCCTTGCCTCTTGG - Intronic
1196827549 X:119752687-119752709 GAAAATGCATATTTAATGCTTGG + Intergenic
1198299212 X:135317907-135317929 GTAACAGCATAGCTGCTACTGGG + Intronic
1200359873 X:155593112-155593134 GATTAGGCAGAGTTGCTGCTTGG - Intronic
1200610131 Y:5317673-5317695 TAAGAAGCATAGTGGCTTCTGGG - Intronic