ID: 987366873

View in Genome Browser
Species Human (GRCh38)
Location 5:17156656-17156678
Sequence CATCAGAGTGAGATCAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 359}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987366873 Original CRISPR CATCAGAGTGAGATCAGGGA GGG (reversed) Intronic
901108485 1:6776377-6776399 CATCAGAGTGAGACTTGAGATGG + Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901938173 1:12642288-12642310 CTTAACAGAGAGATCAGGGAAGG - Intergenic
903052576 1:20612581-20612603 CAGCAAAGGGAGATCAGGGTGGG - Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
903970998 1:27118663-27118685 CACCAGGGTGAAATCAGGGATGG + Intronic
904717178 1:32477353-32477375 TATTGGAGTGAGATCAGGAAAGG + Intronic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904813128 1:33176689-33176711 CCTCAGAGGTAGCTCAGGGACGG + Intronic
905403126 1:37717235-37717257 CTTCAAAGTCAGAGCAGGGAGGG + Exonic
905587161 1:39129578-39129600 AGTCAGAGTAAGACCAGGGATGG + Intronic
905919199 1:41708128-41708150 TATCAGGGTGACATTAGGGAGGG + Intronic
906230886 1:44163056-44163078 GATCATAATGACATCAGGGAAGG - Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906654792 1:47540240-47540262 CATGAGAGTGAGCTCTGTGATGG + Intergenic
906665343 1:47617500-47617522 CATCAGGGCCAGGTCAGGGAGGG - Intergenic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
906870285 1:49471866-49471888 CATCAGAGTGGTGTCAGAGATGG + Intronic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908423787 1:63985163-63985185 CAACAAATTGAGATCAGGAAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908774686 1:67628458-67628480 CAGGAGAGAGGGATCAGGGAGGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910951850 1:92657043-92657065 CATCACCGTGATACCAGGGAAGG + Intronic
911344221 1:96676831-96676853 CATCAGAGTGAGACATGGCAAGG - Intergenic
911870183 1:103087401-103087423 CATCAGAGTGACATGAGACATGG - Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914692379 1:150042190-150042212 CGACAGAGTGAGATGAAGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915549663 1:156624850-156624872 CCTCAGCTTGAGATCAGGGCAGG + Intronic
915580173 1:156808738-156808760 CATCTCAGTGAGCTCAGGGGAGG - Intronic
916505195 1:165422441-165422463 CATGCTATTGAGATCAGGGAAGG + Intronic
916702185 1:167308544-167308566 GGACAGAGTGAGACCAGGGAAGG - Intronic
916795448 1:168162889-168162911 CATCAGAGTTTGTGCAGGGAAGG + Intergenic
917219749 1:172716344-172716366 CATCAGAGTGAGCCCCTGGAGGG + Intergenic
917295924 1:173519165-173519187 CATCAGAGAGAGATGTGTGAAGG + Intronic
917303512 1:173603738-173603760 GAACAGAGTGAGTTCAGGAAAGG - Intergenic
917453815 1:175168907-175168929 AAGCAGAGAGAGAACAGGGAGGG - Intronic
918302486 1:183216684-183216706 CAGCAGAGTGAGAACACAGAGGG - Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
923332359 1:232936866-232936888 GATCAGAGTGAGCTAAAGGAAGG - Intergenic
923459695 1:234197565-234197587 CATCAGGGAGTGATCATGGAGGG - Intronic
923707380 1:236355400-236355422 CATCAAAGAGAGATTAGAGAGGG - Intronic
924836373 1:247651817-247651839 CAACAGAGAGAGAGCGGGGAGGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1067729225 10:48797185-48797207 CATCAGAGTGAGAGCAGCCATGG + Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1071910157 10:90222555-90222577 CATAAGGATGAGATCAGTGATGG - Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1075075338 10:119346666-119346688 CATCAGAATGCCATCAGAGAGGG + Intronic
1075240715 10:120775924-120775946 CATGATTGTGAGGTCAGGGAAGG - Intergenic
1077117325 11:891080-891102 CCTCAGAGTGGGATGGGGGAAGG + Intronic
1077192648 11:1261859-1261881 CGTCCCAGTGACATCAGGGAGGG - Exonic
1077485907 11:2838363-2838385 CTGCAGAGTGAGGCCAGGGATGG + Intronic
1077514491 11:2993133-2993155 CATGAGAGGGAGAACAGGGCGGG - Intergenic
1077724304 11:4658779-4658801 CAACAGAGTGAGTTCAGGAAAGG + Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078472681 11:11604403-11604425 CAGCAGTGTGGGATCAGGAATGG - Intronic
1078858926 11:15229568-15229590 CATCATAATGACATGAGGGAGGG - Intronic
1079594397 11:22224182-22224204 CATCAGTGTAAGATAAGGAAAGG - Intronic
1080660541 11:34292728-34292750 CCTCATAGGGAGGTCAGGGAGGG + Intronic
1080872797 11:36251793-36251815 CAACAGAGAGATATCAGGGAGGG - Intergenic
1081194071 11:40139886-40139908 CATCAGAGACAGAACAGTGATGG - Intronic
1081228532 11:40555500-40555522 CATCTGAGTGAGAGCAAGAAAGG - Intronic
1081853971 11:46292277-46292299 CATCAGAGCAAGATTCGGGACGG + Intronic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083592092 11:63901829-63901851 CACCAGAGGGAGAGCAGGGCAGG - Intronic
1084364588 11:68689414-68689436 CGACAGAGTGAGATGAAGGAAGG - Intronic
1084962699 11:72725662-72725684 AATCAGAGGGAGAGCAGGGAGGG - Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085655379 11:78309833-78309855 CAACAGAGAGAGATCAAGGGTGG + Intronic
1085725611 11:78952223-78952245 AATCAGAGTGAAAATAGGGAAGG - Intronic
1085779294 11:79393909-79393931 CATCAGAGTAAGAACAGGCCTGG + Intronic
1086398733 11:86443366-86443388 CCTCAGACTGAGACCAGGGCTGG - Intronic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087986998 11:104694972-104694994 CACAAGAATGAGATCATGGAAGG - Intergenic
1090432305 11:126656169-126656191 CAGGTGAGTGAGGTCAGGGAGGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092726739 12:11493972-11493994 AATCAGAGTCAGAGCAGGGAGGG - Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094313581 12:29113363-29113385 CTTCAGATTCAGCTCAGGGAAGG - Intergenic
1096773249 12:53949747-53949769 CATCACAGGGAGCACAGGGAAGG + Intergenic
1098069965 12:66662826-66662848 CATCTCAATGAGATCAGGAAGGG - Intronic
1098087228 12:66859583-66859605 CATCCCAGTAAGATAAGGGATGG - Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098411954 12:70195739-70195761 CAGCAGAGCCAGATCATGGAAGG - Intergenic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1100304493 12:93337947-93337969 CAACAGAGTGAGATCAAGATGGG + Intergenic
1102193971 12:111011308-111011330 AATCAGAGTGGGATGTGGGAAGG + Intergenic
1102670492 12:114614905-114614927 CTCCAGAATGAGAGCAGGGAGGG - Intergenic
1103011144 12:117459362-117459384 GAGAAGAGTGAGATAAGGGAGGG + Exonic
1104160984 12:126180864-126180886 CCTCAGAGTGTGATGAGGGTGGG + Intergenic
1104161034 12:126181234-126181256 CCTCAGAGTGTGATGAGGGTGGG + Intergenic
1106448939 13:29862465-29862487 GCTCAGAGTGAGAAGAGGGAAGG - Intergenic
1106719004 13:32419912-32419934 CAGCAGCCTGAGAGCAGGGAGGG + Intronic
1107795982 13:44052310-44052332 CATCAGGAAGAGATGAGGGAAGG - Intergenic
1107988456 13:45796468-45796490 GATGAGAGTCAGATCAGGGACGG + Intronic
1112634741 13:101202795-101202817 CTTTAGAGTGAGAGCAGTGATGG - Intronic
1113265287 13:108609554-108609576 CACTAGAGGGAGATCAGAGAAGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116380849 14:44266041-44266063 TATCTAATTGAGATCAGGGAAGG + Intergenic
1117537859 14:56719039-56719061 GGTGGGAGTGAGATCAGGGAAGG - Intronic
1118720864 14:68592928-68592950 CATCAGAATGGGCTCAGGGTGGG + Intronic
1119143228 14:72286801-72286823 CAACAGAGTGAAAGAAGGGAGGG - Intronic
1121405551 14:93717370-93717392 CTTCAGAGTTAGCTCAGTGAGGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122742409 14:103879953-103879975 CACCCGTGTGAGGTCAGGGAGGG - Intergenic
1122815920 14:104314041-104314063 CTAGAGAGTGAGAACAGGGAGGG - Intergenic
1122863660 14:104593878-104593900 CACCAGAGTGGGTTCCGGGAGGG - Intronic
1202900738 14_GL000194v1_random:35703-35725 GACCAGAGTGAGAACAGAGATGG + Intergenic
1123705803 15:22950390-22950412 CATCAGAGAGAGAGAAGGAAGGG + Intronic
1124949805 15:34306647-34306669 TTTCAGAGTGAGTTCTGGGAAGG - Intronic
1125296960 15:38213618-38213640 GATCAGAGTAATAACAGGGATGG + Intergenic
1125316966 15:38441929-38441951 CAGCTGAGTGAGTCCAGGGAGGG + Intergenic
1125556557 15:40590630-40590652 GAACAGAGTGAGTTCAGGAAAGG + Intergenic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128319822 15:66685297-66685319 CGTCAGAGTGAGCCCAGGGAAGG + Exonic
1128990724 15:72257642-72257664 CTTCATAGGAAGATCAGGGAAGG - Intronic
1130012909 15:80165808-80165830 AAGGAGAGTGAGACCAGGGAGGG + Intronic
1130020459 15:80226448-80226470 GGCCAGAGAGAGATCAGGGAGGG - Intergenic
1130025844 15:80269750-80269772 CAGCAGAGGGAGAGCTGGGATGG - Intergenic
1130123177 15:81069805-81069827 AGCCAGAGTGAGATCAGGTAGGG + Intronic
1130153581 15:81331080-81331102 GAACAGAGTGAGTTCAGGAAAGG + Intergenic
1130297008 15:82654508-82654530 CTTCAGAGGGAAGTCAGGGAGGG - Intergenic
1131527257 15:93162364-93162386 GAACAGAGTGAGTTCAGGAAAGG + Intergenic
1131534274 15:93221588-93221610 GAACAGAGTGAGTTCAGGAAAGG + Intergenic
1131997796 15:98148434-98148456 CATCAGAGGGACATCAGTGCAGG - Intergenic
1134207213 16:12248055-12248077 CACCAGAATGAAAGCAGGGAGGG - Intronic
1134603384 16:15550929-15550951 CATCAGCTTGAGAGGAGGGATGG + Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139109739 16:63875072-63875094 CAACAGAGGGAGGTAAGGGAAGG - Intergenic
1139443320 16:66979875-66979897 CATCTGAGGGAGAGCAGGGCTGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1141007210 16:80363591-80363613 GATCTGGGTGAGGTCAGGGAAGG - Intergenic
1142479998 17:213391-213413 CATCAGAGCCAGAGCAGTGAGGG - Exonic
1142805147 17:2367535-2367557 CATCGGGGGCAGATCAGGGAGGG + Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1142906971 17:3049975-3049997 CATCAGAATGGGAACAGGGAGGG + Intergenic
1143483526 17:7239949-7239971 CGGCAGAGTGGAATCAGGGAGGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146540177 17:33686890-33686912 CAGTAGAGTTACATCAGGGAGGG + Intronic
1150065862 17:62108905-62108927 CAAGAGAGTGAGATAAAGGATGG - Intergenic
1151400773 17:73854573-73854595 CAACATAGTGAGACCAGGCATGG + Intergenic
1151419051 17:73985543-73985565 CCTCACAGTGGGACCAGGGACGG - Intergenic
1151451481 17:74200735-74200757 CAGCAGAGTGAGGGAAGGGAAGG + Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1153336015 18:3925481-3925503 CACCAGAGTGATAACAGGAAGGG - Intronic
1154178202 18:12103176-12103198 CATCAGAGGGAGAGCAAGAAAGG + Exonic
1155630678 18:27888510-27888532 AAGCAGAGTGGGACCAGGGAAGG + Intergenic
1157564867 18:48673034-48673056 CATCTGAGAGGGATCAGGGGAGG - Intronic
1158739198 18:60120364-60120386 CATTAGAGGGAGATGGGGGATGG - Intergenic
1159313815 18:66744417-66744439 GATCAGAGTGAGAGGAGGAAGGG - Intergenic
1161272618 19:3398403-3398425 CACCAGAGTGAGATCCAGGCTGG - Intronic
1161787046 19:6333201-6333223 CATCAGAGTTAGCTTAGGGAAGG + Intronic
1161889096 19:7020934-7020956 CATGACAGTGAGTTTAGGGAAGG + Intergenic
1161892356 19:7049815-7049837 CATGACAGTGAGTTTAGGGAAGG - Intronic
1162249497 19:9430371-9430393 GAACAGAGTGAGTTCAGGAAAGG - Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163000215 19:14362475-14362497 CAACAAAGTGAGACCGGGGAAGG + Intergenic
1163777649 19:19227497-19227519 CATCATAGGGAGATCTGGGGAGG - Exonic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167191342 19:47991935-47991957 GAGCAGAGTGAGAGCAAGGAAGG - Intronic
1167399524 19:49255632-49255654 CCACAGAGGGAGATCGGGGATGG + Intergenic
1167647384 19:50713086-50713108 CATCTGAGGGAGAGAAGGGAGGG + Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1202643688 1_KI270706v1_random:121938-121960 GACCAGAGTGAGACCAGAGATGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925741729 2:7010778-7010800 CACCTGGGTGGGATCAGGGAAGG - Intronic
927970730 2:27304953-27304975 TATCAGAGTGAGCTCAGCGATGG + Exonic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929588418 2:43130386-43130408 CATCCCAGTGGGATGAGGGAGGG - Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
931748348 2:65309891-65309913 CATCAGAGTGAGGCCTGGTAAGG + Intergenic
935010073 2:99126073-99126095 CACCAGGGTGATATCAGAGAAGG - Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
936548647 2:113415074-113415096 ATTCAGATTGAAATCAGGGACGG - Intergenic
937573244 2:123389864-123389886 AATGAGAGTGTGATGAGGGAAGG + Intergenic
937760808 2:125601350-125601372 CATCAAAGTAAGAGCAGGAAAGG - Intergenic
938123818 2:128656011-128656033 TATCAGAGTGGTATCAGGGAAGG - Intergenic
938271795 2:129978953-129978975 AAACAGAGAGAGATGAGGGAGGG + Intergenic
938444208 2:131364853-131364875 AAACAGAGAGAGATGAGGGAGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938631998 2:133177706-133177728 CATGGGAGTGGTATCAGGGAAGG + Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941842530 2:170102117-170102139 CATCTGGGTGAGGTCATGGAGGG - Intergenic
942554744 2:177160191-177160213 CATCAAAGGGAGATCATGGTGGG + Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945785189 2:214225421-214225443 GATCAGAGTGAAAGCAGGGAAGG + Intronic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946212777 2:218161041-218161063 CATCAGGGTAAGGTGAGGGACGG - Intergenic
946416498 2:219542806-219542828 CCTCAGGGTGAGATGGGGGAGGG - Intronic
946807362 2:223484591-223484613 TATCAGAGAGATATAAGGGAAGG - Intergenic
947542479 2:230988505-230988527 CCTCAGTGTGACCTCAGGGAGGG - Intergenic
947740055 2:232480892-232480914 CTTCACAGGGAGAGCAGGGAGGG - Intronic
948000288 2:234562189-234562211 CATCAGGGGGAGACCATGGAAGG - Intergenic
948186552 2:236026018-236026040 CAGCAGAGTGAAGCCAGGGATGG - Intronic
948256301 2:236570742-236570764 CTTTGGAGTGAGGTCAGGGATGG + Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1171893653 20:30740889-30740911 GACCAGAGTGAGACCAGAGATGG - Intergenic
1172663005 20:36580195-36580217 GTTCAGAGTGGGATAAGGGAAGG - Intronic
1173761826 20:45568210-45568232 CATCAGAGTACAATCATGGATGG + Intronic
1173946392 20:46954178-46954200 CATGACAGGGTGATCAGGGAAGG - Intronic
1174282089 20:49446870-49446892 CTTCAGAGGGAGATGAGGGATGG - Intronic
1175457325 20:59125252-59125274 CAGCAGGGTGAGGCCAGGGATGG - Intergenic
1176288390 21:5031415-5031437 AATCAAAGTGAGGTCAGGCACGG - Intronic
1176608194 21:8850690-8850712 GACCAGAGTGAGACCAGAGATGG + Intergenic
1176620112 21:9050481-9050503 GACCAGAGTGAGAACAGAGATGG + Intergenic
1178109693 21:29357739-29357761 CATCACAGAGAGAGCAAGGATGG - Intronic
1179521964 21:41951541-41951563 CAGCAGAGAGAGAACAGAGAAGG + Intronic
1179842687 21:44087480-44087502 CTTCAGATTGAGATCAATGATGG + Intronic
1179868792 21:44232060-44232082 AATCAAAGTGAGGTCAGGCACGG + Intronic
1181439599 22:22928940-22928962 GTTCTGAGTCAGATCAGGGAGGG + Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181957274 22:26597062-26597084 AATGAAAGTGAGATGAGGGAAGG + Intergenic
1181993485 22:26856514-26856536 CATCATAGTGACATCAAGAATGG - Intergenic
1182456485 22:30454203-30454225 CAACAGAGTGACACCAGTGAAGG - Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183728610 22:39604384-39604406 CATCCTTGGGAGATCAGGGAGGG + Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184342516 22:43893730-43893752 CACCAGTGTGAGTTCAGGAAGGG + Intergenic
1184431741 22:44445090-44445112 CAGGTGGGTGAGATCAGGGAAGG + Intergenic
1184654233 22:45933101-45933123 CATCAGGGTGAGGACTGGGATGG + Intronic
1185283869 22:49990568-49990590 CAACAGAGGGAGACCAGAGAGGG + Intergenic
1203291999 22_KI270736v1_random:3654-3676 CATCAGAGTGGCTTCAGGAAGGG - Intergenic
949130623 3:496037-496059 CCACAGAGTCAGATCATGGATGG - Intergenic
950548017 3:13650344-13650366 CATTATAGTGGCATCAGGGAAGG + Intergenic
951201579 3:19881206-19881228 CTGCAGAGTGAGCTCAGGAATGG + Intronic
951909700 3:27736904-27736926 CGACAGAGTGAGATCACGGCTGG + Intergenic
952753371 3:36843823-36843845 CAGCAGAGGGCGAGCAGGGAGGG - Intronic
953228650 3:41044036-41044058 CATAAGAGTGAGGTCAGGGAGGG - Intergenic
953336378 3:42097868-42097890 CATCAGAGTGTGCTCTGGGAAGG + Intronic
953498040 3:43405396-43405418 CAACACAGTGAGTTCATGGATGG - Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954812619 3:53257303-53257325 CCCCAGAGTGGGATTAGGGAGGG + Intergenic
956643159 3:71433508-71433530 CATCAGAGAGAGGGCAGGCAGGG + Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960648776 3:119922115-119922137 CAACAGAGTGAAATGAAGGAAGG + Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961330472 3:126135295-126135317 CAGCAGAGTGGGCTCAGGGGAGG - Intronic
961647776 3:128401529-128401551 CATCAGAGTGTGAGCATGGCAGG + Intronic
962508353 3:136071964-136071986 AAACAGAGAGTGATCAGGGAGGG - Intronic
962905037 3:139793741-139793763 CACCAGAATGGAATCAGGGAAGG + Intergenic
963112906 3:141701469-141701491 AATTAGAGAGAGATCAGTGAGGG + Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
965663824 3:171070187-171070209 CATAAAAGTGAGGTCATGGAGGG + Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
968152241 3:196346091-196346113 TATCAGAATGAGATCACAGAGGG + Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969262387 4:6042326-6042348 CCTCAGAGTGTGCTCAGGAATGG + Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970556508 4:17238966-17238988 CATCAGAGTCTAATTAGGGAGGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
974649659 4:64738154-64738176 CATCAAAGGGAGATAAGGGTGGG - Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
977646262 4:99416308-99416330 AATCAGAGTGGGCTCAGAGAGGG - Intronic
977861013 4:101959938-101959960 CTTGAGGATGAGATCAGGGAAGG - Intronic
978374247 4:108058617-108058639 AATCGGAGTGAAATCAAGGAAGG - Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
980011296 4:127597470-127597492 CATCCAAATGAGAACAGGGAGGG + Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982438350 4:155402992-155403014 CATCAGCTTTAGATCAGTGATGG + Intergenic
984719351 4:182955529-182955551 CATCAGTGTGAGATGAGGGAGGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1202771058 4_GL000008v2_random:207870-207892 GACCAGAGTGAGACCAGAGATGG - Intergenic
985946748 5:3191121-3191143 CAGGGGAGTGAGAGCAGGGAGGG - Intergenic
986009073 5:3695609-3695631 CATCAGAGTTCAATCAGAGAAGG - Intergenic
986772746 5:10988509-10988531 CCTCAGAGAGAGATCATGGAGGG + Intronic
987366873 5:17156656-17156678 CATCAGAGTGAGATCAGGGAGGG - Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990366086 5:55071290-55071312 CATGAAAGTGAGATGAGGGAGGG + Intergenic
990497563 5:56363837-56363859 ATTCAGAGTGAGATCTGGGTGGG - Intergenic
990931829 5:61100418-61100440 AACAAGAGTGAGCTCAGGGATGG - Intronic
991145886 5:63303164-63303186 CCTCAGAGTGGGAGAAGGGATGG - Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
994443617 5:99843111-99843133 CATCTGAGTGACTTAAGGGATGG - Intergenic
997005374 5:129810656-129810678 CATCAGTCTGAGATCAGGATTGG + Intergenic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1001937570 5:175716212-175716234 CATCCATGTGGGATCAGGGAAGG - Intergenic
1002470879 5:179435426-179435448 CATCAGTGTTTGCTCAGGGATGG + Intergenic
1002767352 6:253964-253986 TATCTGAGTGGGATCTGGGAGGG - Intergenic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1004095231 6:12547697-12547719 AATCAGAGTTAGTTCAGAGAAGG - Intergenic
1005244953 6:23872965-23872987 CAGCAAAGGGAGATCAGGCACGG - Intergenic
1006397953 6:33799254-33799276 CATCAGCGTGGGTTGAGGGAGGG - Intronic
1006680792 6:35795651-35795673 CTTGTGAGTGGGATCAGGGAGGG - Intronic
1006852074 6:37105784-37105806 CAGGACAGTGAGATCAGAGAAGG + Intergenic
1007354699 6:41305556-41305578 CCTCAGGGAGAGATTAGGGAGGG + Intergenic
1007363034 6:41372215-41372237 CATGAAAATGAGGTCAGGGAAGG - Intergenic
1007869136 6:45012985-45013007 CTTAATAGGGAGATCAGGGAAGG - Intronic
1008424485 6:51341193-51341215 GATAAGAGTGAGATCAAAGAAGG - Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008827171 6:55710388-55710410 CATCAGACCAAGATCAGTGATGG - Intergenic
1011260213 6:85462349-85462371 CATCGCTGGGAGATCAGGGAGGG - Intronic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1013582434 6:111549665-111549687 CATCAATGTGAGCTCAGTGAGGG + Intergenic
1014214164 6:118736840-118736862 CATCAGAGGCAGAGAAGGGAAGG + Intergenic
1014627880 6:123751904-123751926 ATTCATAGTGAGACCAGGGAGGG + Intergenic
1015546653 6:134368434-134368456 CATGAGAGCGAGAGCAGGCAAGG + Intergenic
1017237662 6:152133691-152133713 AATCAAACTGAGATCAGAGACGG - Intronic
1017980237 6:159394791-159394813 AAGTTGAGTGAGATCAGGGAGGG + Intergenic
1018735331 6:166683695-166683717 CATCAGACTGAGAACACAGAAGG + Intronic
1019075301 6:169382376-169382398 CATCAGAATGAGGGGAGGGAGGG + Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019522798 7:1468250-1468272 CCTCAGGGTCTGATCAGGGAGGG - Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1020713044 7:11632690-11632712 CATCAGACTGAAAGCTGGGACGG - Intronic
1021325000 7:19255744-19255766 TATCAGAGTAAGATCATGCATGG - Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1021804113 7:24338380-24338402 AGGCAGAGTGAGATCAGGGCTGG - Intergenic
1022026744 7:26455120-26455142 CATAAGAGTGGGATAAGGCAAGG + Intergenic
1022221408 7:28317264-28317286 CATCAGTGTGAAACCAGGGTGGG + Intronic
1023137379 7:37065880-37065902 GCTCAGAGTGAGATCTGGGTGGG - Intronic
1023733764 7:43217071-43217093 CAGGAGAGTGTGATCAGAGAAGG - Intronic
1024345679 7:48310708-48310730 CAGCAGTGTGAGGGCAGGGAGGG + Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1027513074 7:79108075-79108097 CATCAGAGAGTGTTTAGGGAAGG + Intronic
1031810305 7:126359337-126359359 CATCAGAGTGTTGTGAGGGAAGG + Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033387783 7:140895657-140895679 CATAAGAGTGAGAACATGCAGGG + Intronic
1034023614 7:147672067-147672089 CATCAGAATGAAATCACTGAAGG + Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035602225 8:903325-903347 CATCAGTTCGAGAGCAGGGAGGG + Intergenic
1036017404 8:4800572-4800594 CGTCAGAGGCAGAGCAGGGAAGG + Intronic
1036761481 8:11512387-11512409 CGTCAGAGTGATTTCAGGGTGGG - Intronic
1038419389 8:27422581-27422603 CAGGAGAGTGAGACTAGGGAGGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039346104 8:36707478-36707500 CTTTAGAATGAGATGAGGGAGGG - Intergenic
1039704433 8:39992289-39992311 CAGCAGAGTGATCTCAGGGTAGG - Intronic
1039831947 8:41222394-41222416 CAACAGAGTAAAATCAGGCATGG - Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040816920 8:51518579-51518601 CATGAGAATGAGGTCAGTGATGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041331118 8:56725987-56726009 CATAAAAGTGAGATCAGGCCAGG - Intergenic
1042246626 8:66714506-66714528 TATGAGAGAGAGATAAGGGAGGG - Intronic
1043533113 8:81171976-81171998 GAGCAGAGAGAGACCAGGGACGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047696194 8:127406187-127406209 CAACAGAGTGAGATGAAAGAAGG + Intergenic
1048172635 8:132122328-132122350 CACAAAAGTGAGGTCAGGGAAGG - Exonic
1048498983 8:134958801-134958823 CAGCAAAGAGAGATCAGAGAAGG + Intergenic
1049551941 8:143264076-143264098 CATCAGAGAGAGATAGGGGTTGG - Intronic
1049904353 9:202098-202120 ATTCAGATTGAAATCAGGGATGG + Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051412878 9:16809251-16809273 CATCAGAGAGTGATCCAGGAGGG - Intronic
1052246114 9:26337389-26337411 CATCACAGTGAGTTAAGGAAGGG + Intergenic
1053035482 9:34823871-34823893 CACCAGACTGAGATCCTGGAAGG + Intergenic
1053726921 9:41013672-41013694 ATTCAGATTGAAATCAGGGACGG + Intergenic
1055083906 9:72294769-72294791 CATCAGTGTAAGATTAGGAAAGG + Intergenic
1056822056 9:89849911-89849933 CATCAGTGGAAGATCAGGGTAGG + Intergenic
1056829352 9:89902253-89902275 CATCAGAGTGGGGTCATGGCTGG - Intergenic
1057278028 9:93686605-93686627 GTCCAGAGTGAGAGCAGGGAAGG + Intergenic
1059425610 9:114219155-114219177 CTCCAGAGTGGGGTCAGGGATGG + Intronic
1060332492 9:122685915-122685937 CAAGAGAGTGAGGGCAGGGAGGG - Intergenic
1062098271 9:134713909-134713931 CAGCAGACTGAGACCAGTGATGG + Intronic
1203743318 Un_GL000218v1:20936-20958 GACCAGAGTGAGAACAGAGATGG + Intergenic
1203703596 Un_KI270742v1:15904-15926 GACCAGAGTGAGACCAGAGATGG + Intergenic
1203566788 Un_KI270744v1:98576-98598 GACCAGAGTGAGAACAGAGATGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189095162 X:38130648-38130670 CAGTAGAGAGTGATCAGGGAGGG - Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1190798007 X:53761680-53761702 CCTCAGTGTGAGCTGAGGGAGGG - Intergenic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1194971308 X:100347243-100347265 CATCAGCGGGAGATCAGAGCAGG + Intronic
1195484725 X:105390951-105390973 CATCATTGTGAGATCTGTGATGG - Intronic
1195870242 X:109478169-109478191 CATGAGAGTGAGATACAGGATGG + Intronic
1197178618 X:123510806-123510828 CATCAGTGTGAGTTGAGGGAAGG - Intergenic
1198387068 X:136139102-136139124 CATCAAAGTCAGATTAGTGATGG - Intergenic
1201156847 Y:11138407-11138429 GACCAGAGTGAGAACAGAGATGG + Intergenic