ID: 987374014

View in Genome Browser
Species Human (GRCh38)
Location 5:17217833-17217855
Sequence CCCCGGGTCCGCGGCGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 400}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987374014_987374031 22 Left 987374014 5:17217833-17217855 CCCGCGCCGCCGCGGACCCGGGG 0: 1
1: 0
2: 5
3: 45
4: 400
Right 987374031 5:17217878-17217900 CGCCCCGCCCCGCAGCCCCCGGG 0: 1
1: 2
2: 8
3: 143
4: 868
987374014_987374030 21 Left 987374014 5:17217833-17217855 CCCGCGCCGCCGCGGACCCGGGG 0: 1
1: 0
2: 5
3: 45
4: 400
Right 987374030 5:17217877-17217899 GCGCCCCGCCCCGCAGCCCCCGG 0: 1
1: 1
2: 18
3: 115
4: 790

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987374014 Original CRISPR CCCCGGGTCCGCGGCGGCGC GGG (reversed) Intronic