ID: 987374419

View in Genome Browser
Species Human (GRCh38)
Location 5:17219632-17219654
Sequence AACGCCCACTGACAGTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 57}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987374419_987374427 18 Left 987374419 5:17219632-17219654 CCTCAAAACTGTCAGTGGGCGTT 0: 1
1: 0
2: 2
3: 3
4: 57
Right 987374427 5:17219673-17219695 TGGGGAAAATTAAGACATCTTGG 0: 1
1: 0
2: 2
3: 18
4: 269
987374419_987374422 0 Left 987374419 5:17219632-17219654 CCTCAAAACTGTCAGTGGGCGTT 0: 1
1: 0
2: 2
3: 3
4: 57
Right 987374422 5:17219655-17219677 GCCTCCAGTGACACCACCTGGGG No data
987374419_987374421 -1 Left 987374419 5:17219632-17219654 CCTCAAAACTGTCAGTGGGCGTT 0: 1
1: 0
2: 2
3: 3
4: 57
Right 987374421 5:17219654-17219676 TGCCTCCAGTGACACCACCTGGG No data
987374419_987374420 -2 Left 987374419 5:17219632-17219654 CCTCAAAACTGTCAGTGGGCGTT 0: 1
1: 0
2: 2
3: 3
4: 57
Right 987374420 5:17219653-17219675 TTGCCTCCAGTGACACCACCTGG 0: 1
1: 0
2: 2
3: 19
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987374419 Original CRISPR AACGCCCACTGACAGTTTTG AGG (reversed) Intronic
900302964 1:1987083-1987105 CACGCCCACTGTCACTTTGGAGG - Intronic
907888885 1:58619500-58619522 AAACCCCACTGCCAGTTTGGAGG - Intergenic
909686266 1:78352801-78352823 AAGGCCCAATGACATTTTAGAGG + Intronic
1066633532 10:37479635-37479657 ATGGCCCACTGACAGTGATGTGG + Intergenic
1066795644 10:39117327-39117349 AAAGCCCATTGACACCTTTGGGG + Intergenic
1075992376 10:126849032-126849054 AATGTGCACTGAGAGTTTTGGGG - Intergenic
1077194841 11:1274173-1274195 CACGCCCACTGCCACTGTTGAGG + Intergenic
1099043600 12:77687175-77687197 AACAGCCACTCACAGTTTTCCGG - Intergenic
1105954638 13:25268939-25268961 AACTCCCACTGCCTGTTCTGTGG + Intronic
1108297691 13:49041114-49041136 TACGCCCACTCACAGGTTTCTGG - Intronic
1113402123 13:110003977-110003999 AAGGCCCACCCACATTTTTGAGG - Intergenic
1115021866 14:28691513-28691535 AACTCCCACTGATAGTATGGAGG + Intergenic
1122409566 14:101518937-101518959 AACTCCTACTGGCAGTCTTGGGG - Intergenic
1126587285 15:50301503-50301525 AAGGTCCACTGACAGTGTAGGGG + Intronic
1132702333 16:1227160-1227182 CACGCCCACTGGAGGTTTTGCGG - Intergenic
1132705992 16:1243708-1243730 CACGCCCACTGGAGGTTTTGCGG + Intergenic
1135607902 16:23838627-23838649 AGCACTGACTGACAGTTTTGTGG + Intronic
1147399332 17:40170397-40170419 AAGGCCCACTAACACTTTGGTGG + Intronic
1153245530 18:3069684-3069706 AACACCCCCTGACAGTCTAGTGG + Intronic
1153315605 18:3718552-3718574 AACCCCCACTGACAGAATTGTGG + Intronic
1167512586 19:49903601-49903623 AAAGCACCCTGACATTTTTGGGG + Intronic
927884571 2:26710560-26710582 AAGGCCCACAGACAGTGTAGGGG + Intronic
928729909 2:34219730-34219752 AACGCCCACTGATTCCTTTGAGG - Intergenic
932908949 2:75785192-75785214 AATCCCCTCTGACAGTTTTGGGG + Intergenic
935387821 2:102519781-102519803 AAGGCCCACTGATAGTTTTGTGG + Intronic
935785696 2:106546573-106546595 ACTGCCCACTGACAGTCCTGAGG - Intergenic
939204581 2:139084027-139084049 AGCCCCCTCTGGCAGTTTTGTGG + Intergenic
945160106 2:206881617-206881639 AGAGCCCAATGACAGTTTTTAGG + Intergenic
947891605 2:233626979-233627001 AACACCCACTGACAGTTTTTTGG - Intronic
1178963223 21:37087733-37087755 AATGCCCACTGAAAGTTCTTTGG + Intronic
1180867163 22:19126250-19126272 AACCCCCACTGGCAGCCTTGTGG - Intergenic
960821562 3:121738536-121738558 AATGCCCACTGGCTCTTTTGAGG - Intronic
962168541 3:133076721-133076743 AAGGCCAACAGACAGTTTTCTGG + Intronic
965419614 3:168441513-168441535 AACACACACTGACACTTTTACGG - Intergenic
968062587 3:195737345-195737367 AGAGCCCACTGAAAGTTTCGGGG - Intronic
969263164 4:6046448-6046470 AACCCCTACTGACGGTTATGGGG - Intronic
971134889 4:23857620-23857642 AACAACCAGTGACAGTTCTGAGG - Intronic
975885452 4:78959262-78959284 AACACCCCCAGACAGGTTTGTGG - Intergenic
978768038 4:112424889-112424911 ACCGACCACTGACAGTTTTCAGG + Intronic
982283001 4:153704995-153705017 AAAGCACAAAGACAGTTTTGTGG - Exonic
987374419 5:17219632-17219654 AACGCCCACTGACAGTTTTGAGG - Intronic
988822753 5:34903834-34903856 AACAAGCACTGACATTTTTGAGG + Intergenic
990729510 5:58793144-58793166 AGGGCCCACTGAGAGGTTTGAGG - Intronic
990985572 5:61638273-61638295 ACCTCCCCCTCACAGTTTTGGGG - Intronic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1000451279 5:161391046-161391068 AACCAGCAATGACAGTTTTGTGG + Intronic
1007293397 6:40803457-40803479 CAGGCCCATTGACAGGTTTGGGG - Intergenic
1017712739 6:157184585-157184607 GACGCCCACTGGCAGTGTTAAGG + Intronic
1021791974 7:24215162-24215184 AAAGCCCCCTGACAGTTTAAAGG + Intergenic
1022219276 7:28296235-28296257 TAAGCACACTGACAGTGTTGTGG - Intergenic
1023442554 7:40199240-40199262 AATGCACTCTGACAGTTGTGTGG + Intronic
1026404783 7:70053831-70053853 AACCACCACAGTCAGTTTTGGGG + Intronic
1027689737 7:81329086-81329108 AATACCAATTGACAGTTTTGTGG + Intergenic
1029487732 7:100853432-100853454 AACCCCTGCTGACAGGTTTGGGG + Intronic
1037295162 8:17391838-17391860 AACCCCCACTTAATGTTTTGTGG - Intronic
1044408780 8:91861599-91861621 ATGTCACACTGACAGTTTTGTGG - Intergenic
1047198103 8:122740085-122740107 GACGGGCACTGACAGTTCTGAGG - Intergenic
1054856244 9:69902379-69902401 TAATCCCACTCACAGTTTTGAGG - Intronic
1056395350 9:86176489-86176511 AGCGCCCAGTGACAGCTCTGTGG - Intergenic
1187287008 X:17915351-17915373 AATGCCCACTTAATGTTTTGTGG - Intergenic
1191842753 X:65524785-65524807 TAGCCCCACTGACAGTTGTGGGG - Intronic
1193979500 X:88164470-88164492 AACCCCCGCTGACATTTTTTAGG - Intergenic
1198625458 X:138567483-138567505 ACAACCCACTGACAGTTTGGGGG - Intergenic