ID: 987377775

View in Genome Browser
Species Human (GRCh38)
Location 5:17252454-17252476
Sequence CTGTGTGCCATGCAGCAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 269}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987377770_987377775 25 Left 987377770 5:17252406-17252428 CCCTATTTTGTACTTGTGTAAAA 0: 1
1: 0
2: 5
3: 55
4: 536
Right 987377775 5:17252454-17252476 CTGTGTGCCATGCAGCAGAAAGG 0: 1
1: 0
2: 4
3: 38
4: 269
987377771_987377775 24 Left 987377771 5:17252407-17252429 CCTATTTTGTACTTGTGTAAAAA 0: 1
1: 0
2: 3
3: 39
4: 522
Right 987377775 5:17252454-17252476 CTGTGTGCCATGCAGCAGAAAGG 0: 1
1: 0
2: 4
3: 38
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987377775 Original CRISPR CTGTGTGCCATGCAGCAGAA AGG Intronic
900473573 1:2866032-2866054 CTGGGTGCCAGGCTGCAGGATGG - Intergenic
900967024 1:5965908-5965930 CTGTGTCCCATGAAGCGGCATGG + Intronic
901084142 1:6600602-6600624 CTGTGTGAAAGGCAGCTGAAAGG + Intronic
901258296 1:7851097-7851119 CCGTGTGCCAGCCAGCAGAATGG + Intronic
901434639 1:9239695-9239717 CTGTGCGCCAGGCAGGAGGAAGG - Intronic
902883448 1:19388068-19388090 CAGTGTGCCTGGCAGGAGAAGGG - Intronic
906284191 1:44575924-44575946 CTGTGTGACATGCTCCATAATGG + Intronic
906312352 1:44762842-44762864 ATGTGTGCCAACCTGCAGAAGGG - Intronic
906726760 1:48049947-48049969 CTCTGTCCCATGCTGGAGAATGG + Intergenic
906860602 1:49354950-49354972 ATGTGTGCCCTGCAGTGGAATGG - Intronic
907939819 1:59076906-59076928 CTGTGTGCCATGCAGCACTGAGG + Intergenic
907939825 1:59076941-59076963 CTGTGTGCCATGCAGCACTGAGG + Intergenic
912019941 1:105095751-105095773 CTGTGTCTAATGCAGCAGATGGG - Intergenic
912777141 1:112512974-112512996 CTATGTGGGCTGCAGCAGAATGG + Intronic
912971226 1:114285396-114285418 CTGTGTGCCATGCACTAGTTAGG - Intergenic
919739599 1:200973851-200973873 ATGGGTGCCAGGGAGCAGAAGGG - Exonic
920066555 1:203273573-203273595 CTGTGTGCCCTGCAGCGGGGAGG + Intronic
920849481 1:209618863-209618885 CTGTGCTCCATGCTGCAGCAGGG + Intronic
922148192 1:222970208-222970230 CAGTGTGACATGCACCAGCACGG + Intronic
923737214 1:236621894-236621916 CTGTGTGCCAGGAAGGAGCATGG + Intergenic
924567376 1:245210067-245210089 CTCTGTGCCATGCAGCTGGTTGG + Intronic
924645516 1:245873813-245873835 CTGTGTGACAGGCAGCACTACGG + Intronic
924715289 1:246566977-246566999 CTGTGGGCCACACAACAGAAAGG - Intronic
1063663003 10:8046712-8046734 GTTTGTGCCATTCAGAAGAACGG + Intergenic
1065140821 10:22716401-22716423 GTGTGTGTCTTGCAACAGAATGG - Intergenic
1065670805 10:28114536-28114558 CAGAGTGACATCCAGCAGAATGG - Intronic
1065725385 10:28663697-28663719 GTGTGTGCCACCCACCAGAAGGG - Intergenic
1066185248 10:33004316-33004338 CTATGTGCAATCCAGCAAAATGG + Intronic
1067039758 10:42943009-42943031 CTGTGTTCCAGGCAGGAGAAAGG + Intergenic
1067836532 10:49644959-49644981 CTGTGATCCAGGCAGCAGGATGG + Intronic
1068577299 10:58698550-58698572 CTGTGTGCCATGTTTCAGAATGG - Intronic
1071663652 10:87531263-87531285 GTGTGAGCCATGCAGAAGACAGG - Intronic
1072285326 10:93908926-93908948 CAGTGTGCCAATCAGAAGAAAGG + Intronic
1074774724 10:116758979-116759001 CTGTCTGGGGTGCAGCAGAAGGG - Intergenic
1074894211 10:117760945-117760967 CTGTGTGGCATCGGGCAGAAGGG + Intergenic
1074906768 10:117871211-117871233 CTCTGTGACATCCATCAGAAAGG - Intergenic
1075157347 10:119989224-119989246 CTGTGTGCTATGCAGCAAAGTGG + Intergenic
1075545987 10:123355087-123355109 CTGTGTGCCAGGCACCAGCTAGG + Intergenic
1075555179 10:123425652-123425674 CGGTGTTTCATTCAGCAGAAGGG - Intergenic
1076881271 10:133240271-133240293 CTGTGTGCTATGCCACAGACGGG + Exonic
1077127094 11:945132-945154 CCGTGTGCCACGCTGCAGAGAGG + Intronic
1077442944 11:2577189-2577211 CTGTGTGCCAGGCACCGGCAGGG + Intronic
1077454553 11:2670700-2670722 CTGTGGCCCATGGAGCAGGAGGG + Intronic
1078908474 11:15709292-15709314 CTGTATTCCATCCTGCAGAAAGG - Intergenic
1079085005 11:17439083-17439105 CTCTGTGCCAAGCACCAGGAAGG - Intronic
1080401992 11:31944901-31944923 CTATGTGCCAAGCAGAGGAAAGG - Intronic
1080503036 11:32888242-32888264 CTGGGTGCCATGGAGCAGCGGGG + Intergenic
1081454468 11:43207306-43207328 GTGTGAGCCATGCAGAAGATGGG - Intergenic
1083630511 11:64092722-64092744 CTGTGTGCCATGCAGGGGCCTGG - Intronic
1083879999 11:65543679-65543701 CTGTGTGCCACCCAGAAGCAGGG - Intronic
1083904055 11:65658717-65658739 CTGTGTGACAAGGTGCAGAAAGG - Exonic
1084025102 11:66443144-66443166 CTGTTTCCCTTGCAGGAGAAGGG + Intronic
1084275626 11:68049709-68049731 GGGTGTGCCAAGCAGCAGGATGG - Exonic
1084665634 11:70574716-70574738 CTGTGCTCCATGCTGCAGAACGG - Intronic
1085182932 11:74551291-74551313 CTGAGTGCCATGAAGGGGAAGGG - Intronic
1086913271 11:92497237-92497259 GTGAGTGCCAGGCAGCAGAAAGG - Intronic
1088326896 11:108609917-108609939 CTGTGTGGGATGGAGCAGGATGG + Intergenic
1088591676 11:111408792-111408814 CTGTGTGCCAGGCACCAGGTAGG + Intronic
1089735551 11:120548161-120548183 CTGGGTGCCAGGCAGCACAAGGG - Intronic
1089845545 11:121455267-121455289 CTGTGTGACATGCAGCGCATGGG + Intronic
1090108134 11:123873923-123873945 CTATGTCCCATGCAGCAGGATGG + Intergenic
1091275253 11:134345343-134345365 TTGTGTGACAGGCAGCAGCAGGG + Intronic
1091656750 12:2351686-2351708 GTGTCTGCCATGCTGCAGAAGGG + Intronic
1091887106 12:4024886-4024908 CTAAGTGCCAGGCAACAGAAAGG - Intergenic
1092498551 12:9023052-9023074 CTGTGAGCCATCCAGCAAATTGG + Intergenic
1094646879 12:32333678-32333700 CTGTGTGCTATGCATCAAACAGG + Intronic
1096518778 12:52172557-52172579 CTGGTTGCCATGCAGCAAGAGGG + Intronic
1097815166 12:64065695-64065717 CTGTGGGCCAGGCACCATAATGG - Intronic
1099250084 12:80243996-80244018 CTGGGTGCCATGATGAAGAAGGG - Intronic
1100278868 12:93098508-93098530 CTCTGTGCCAGGCACCATAATGG - Intergenic
1100883681 12:99045817-99045839 TTCTAGGCCATGCAGCAGAAAGG + Intronic
1100892043 12:99136350-99136372 CTGTGTGCCTGGCAGCACTAAGG + Intronic
1101581972 12:106049737-106049759 CTGTGTGCCAGGCTGGAGGATGG - Intergenic
1102187552 12:110961009-110961031 CTGTGTTCCAGGCAGAAGGAAGG + Intergenic
1103226900 12:119295602-119295624 CTCTGTGCCAGGCACTAGAAGGG + Intergenic
1103940870 12:124500534-124500556 CTGTGTGCCAGGCACCAGAAGGG - Intronic
1104021378 12:124994341-124994363 CTGTGAGCCAGGCAGCACACTGG + Intronic
1107252655 13:38382544-38382566 CTGTGTGCCAAGCATCACACTGG - Intergenic
1110562456 13:76923731-76923753 GTATTTGCCATTCAGCAGAATGG + Intergenic
1111387851 13:87551700-87551722 CTGTGTGCCATGCAGAAAATGGG + Intergenic
1114214441 14:20645553-20645575 CTGGGTGTCATGCAGGAGAAGGG - Intergenic
1114411987 14:22509558-22509580 TGGTGTGCCATCCAGGAGAATGG - Intergenic
1115669286 14:35591110-35591132 CTGTGTGAGATACAGCAAAATGG + Intronic
1117457763 14:55914820-55914842 CTGTATCCCAGGCAGCAGGAAGG + Intergenic
1122121420 14:99555466-99555488 CTGTGTGCCAGGGAGGAGAAGGG - Intronic
1122143737 14:99676807-99676829 CTCTGTGCCAGGCCGCAGAGGGG + Exonic
1122937269 14:104966040-104966062 CTGTGAGCCATCTTGCAGAAGGG - Intronic
1123029997 14:105447083-105447105 CTGGGTGCCAGTCAGCAGCACGG + Intronic
1123043482 14:105500005-105500027 CTGGGTCCCATGCACCGGAATGG - Intergenic
1123662571 15:22577269-22577291 CAGTGTGACTGGCAGCAGAAAGG + Intergenic
1124261712 15:28198642-28198664 CAGTGTGACTGGCAGCAGAAAGG - Exonic
1124316373 15:28671570-28671592 CAGTGTGACTGGCAGCAGAAAGG + Intergenic
1124624198 15:31298925-31298947 CTGTGGGCCTTGCGCCAGAAGGG - Intergenic
1126152912 15:45539186-45539208 ATGGGTGCCATGCAGGAGAGTGG - Intergenic
1126534719 15:49749041-49749063 CTGTGTGCCCTGAAGCAGGGAGG + Intergenic
1126667980 15:51092501-51092523 CTGACTGCCATTTAGCAGAATGG + Intronic
1128404428 15:67320995-67321017 CTGTGAGCTATTCTGCAGAAAGG - Intronic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1128702451 15:69814125-69814147 CTGTGTGCCCGGCACCAGATGGG + Intergenic
1129378780 15:75152602-75152624 GGGTGTGCCAAGCACCAGAAAGG + Intergenic
1132009261 15:98260602-98260624 GTGTTAGCCATTCAGCAGAAGGG - Intergenic
1132313592 15:100875250-100875272 CTGTGTTCCAGGCAGCAGAAAGG + Intergenic
1132558034 16:581026-581048 CTGTGGGCCCTGCAGAAGCAAGG + Intronic
1135532291 16:23265130-23265152 CTGTGTGGCAGGCAGAATAATGG - Intergenic
1136182708 16:28565393-28565415 AGGTGTGCAGTGCAGCAGAAAGG + Intronic
1136452642 16:30362367-30362389 CTGTGTGAAATGCTGCTGAAGGG - Intronic
1137529222 16:49266540-49266562 CAGTGTGTCTTGCAGGAGAAAGG - Intergenic
1137742528 16:50794441-50794463 CTGTGCCACATGCAGAAGAAAGG - Intronic
1137933774 16:52613789-52613811 ATGTGTGCCATGCTGGAGCAAGG + Intergenic
1138615871 16:58165992-58166014 CTGGGTGGCATGCAGAAGAGTGG + Intronic
1139166460 16:64571182-64571204 CTGTGTGAGAAGCAGCTGAATGG + Intergenic
1141442315 16:84037322-84037344 CTGTGTGGCATGAAGCAGGATGG + Intronic
1141736951 16:85860268-85860290 ATGTCTGCCATGCACCAGACAGG + Intergenic
1141802159 16:86317422-86317444 CAGCGTCTCATGCAGCAGAAGGG - Intergenic
1141824406 16:86468785-86468807 CTCTGTTCAATGCAGCAGAGAGG + Intergenic
1142347916 16:89565740-89565762 CTCTGTGCCAGGCCGCAGACAGG + Exonic
1144769751 17:17752907-17752929 CTGTGTGCCAGGCCACAGACAGG - Intronic
1147369351 17:39980962-39980984 CCGGGTGCCATGAAGCAGGAGGG + Exonic
1149030618 17:52078769-52078791 GTGAGTGCCATGCAGCTCAATGG - Intronic
1150128711 17:62654666-62654688 TTGTGTGCCTTGAAGCAGACAGG + Intronic
1150936985 17:69647313-69647335 CTGTGTCCCAGTCAGCAGACTGG + Intergenic
1151666361 17:75547301-75547323 CTATGTGCCAGGCATCAGAGGGG + Intronic
1152307522 17:79529924-79529946 GGCTGTGCCATGCAGCAGGAAGG - Intergenic
1152519109 17:80845170-80845192 CTGGGTGCCATGGAGCAGGTGGG - Intronic
1153652578 18:7254417-7254439 CTGAGCTCCATGCAACAGAAAGG + Intergenic
1154315591 18:13301029-13301051 GTGTGTGCCCTGCAGCTGAAGGG + Intronic
1155059331 18:22214852-22214874 GTGTGTCCCATCCAACAGAACGG + Intergenic
1155491305 18:26404542-26404564 CTGTGGGCCATGCAGGAGGAGGG + Intergenic
1156795875 18:41045582-41045604 CTGTGTGTCTGGAAGCAGAATGG - Intergenic
1157695950 18:49723757-49723779 CAGTGTGGGATGCAGGAGAAGGG + Intergenic
1158380386 18:56923539-56923561 CTGTGTTAGATGCAGAAGAAAGG + Intronic
1158435498 18:57433036-57433058 CGGTGTGCCTGGGAGCAGAAAGG - Intergenic
1158510406 18:58085331-58085353 CCGTGTGCCAGGCAGCAGTGTGG + Intronic
1160059752 18:75518220-75518242 CTGTTTGTCCTGCTGCAGAAAGG - Intergenic
1162018628 19:7858630-7858652 CTGTGTCACAGGCAGCAGACAGG + Intronic
1162219987 19:9168136-9168158 CTTTCTGCCATTCAGCACAACGG + Intergenic
1164827834 19:31297298-31297320 CTGTGTGGCAGGCAGGACAATGG + Intronic
1165601027 19:37056116-37056138 CTGTGTGGCAGGGAGCCGAAGGG + Intronic
1165988977 19:39795124-39795146 CACTGAGACATGCAGCAGAAGGG - Intergenic
1167998221 19:53423991-53424013 CTGTGTCCCTTGGAGCAGATGGG + Intronic
925216173 2:2097446-2097468 CTGTGTGCCCTGCAGAAGCCTGG - Intronic
926630903 2:15135510-15135532 CTGTGTACCGTGCAGCAGGGCGG - Intergenic
927090253 2:19705170-19705192 ATAAGTGACATGCAGCAGAAGGG - Intergenic
927688567 2:25190665-25190687 CTATGTGCCAGGCAGGAGAGAGG + Intergenic
928208866 2:29308789-29308811 CTCTTTTCCATGCAGGAGAAAGG - Intronic
928284767 2:29980198-29980220 CTGATTGCCCTGCAGAAGAAAGG - Intergenic
931141450 2:59462866-59462888 CTGTTTGCAATGCTGCGGAAAGG - Intergenic
931753803 2:65353958-65353980 CAGTGTGCCATGCACCAGTCTGG + Intronic
932953275 2:76318638-76318660 CCCTGTTCCATGCAGCAGCATGG + Intergenic
932994016 2:76826669-76826691 CTTTGTGCCATTCAGAAGAAAGG + Intronic
933376142 2:81481999-81482021 TTGTGTGACATCCAGAAGAAAGG + Intergenic
933576793 2:84078710-84078732 CTGTGTACCAGACAGCAGGATGG - Intergenic
933595442 2:84278519-84278541 CTGTGTGCTGTACAGCAAAAGGG - Intergenic
934735433 2:96687600-96687622 CTGGGAGCCATGAAGCAGAGAGG - Intergenic
935195048 2:100808715-100808737 ATGTGTGCCATGAGGAAGAAAGG + Intergenic
936401384 2:112167043-112167065 CTGCCTGCCACTCAGCAGAAGGG + Intronic
938139852 2:128786555-128786577 CACTGTGGCATGCATCAGAATGG + Intergenic
939465335 2:142547352-142547374 CTCTGTGCCAAGCAGGAGAGAGG - Intergenic
939967130 2:148621356-148621378 GTGTGTGGCCTGCAGCAGAGGGG - Intergenic
940808464 2:158215441-158215463 CTGTATGCCATGGTTCAGAAGGG + Intronic
942854848 2:180532656-180532678 GTGTGAGCCATGCAGAAGACAGG - Intergenic
943787243 2:191891711-191891733 CTGTCTGCCTTGGTGCAGAAAGG - Intergenic
943934922 2:193903928-193903950 CTGTGAGCCAGGCAGAAGACGGG + Intergenic
946165281 2:217859778-217859800 CCGAGAGCCATGCAGCTGAAAGG + Intronic
946798876 2:223388174-223388196 TTGTTTGCCATTCAGCAGAGTGG + Intergenic
948717450 2:239874455-239874477 CTGAGTGCCGTGAAGCAGGAAGG - Intergenic
1169536006 20:6541187-6541209 CTGTATTCCAGGCAGCAGAAAGG - Intergenic
1170151910 20:13235440-13235462 CTGTGTCCCATTCAGTAAAATGG + Intronic
1170551637 20:17481916-17481938 CTGAGTGCCATGCAGCATCAGGG - Exonic
1172563959 20:35913579-35913601 CAGTGTGCCCTGCTGCAGGATGG + Intronic
1172639044 20:36430071-36430093 CTGTCTGCCATGGAGCAGAGAGG - Intronic
1172903126 20:38349382-38349404 CTGTGTGCCAGGTAGCATGAGGG - Intronic
1172989092 20:39018743-39018765 CTGTGTGCCTTCCAACACAATGG + Intronic
1174513614 20:51074731-51074753 CTGTGTCCCACACAGCATAAAGG - Intergenic
1174858438 20:54068373-54068395 CTATGTGCCAGGCAGCACCAGGG + Intronic
1175370702 20:58488169-58488191 CAGGGTGGGATGCAGCAGAATGG - Intronic
1175738367 20:61403104-61403126 CTGTGTTCCATGCAGGAAAAAGG - Intronic
1176308257 21:5135653-5135675 CCGTGTGCTGTGCAGCAGACGGG + Intronic
1179848803 21:44126379-44126401 CCGTGTGCTGTGCAGCAGACGGG - Intronic
1181589993 22:23878049-23878071 CTAACTGCCAGGCAGCAGAATGG + Intronic
1181969058 22:26676484-26676506 CTGTGGCCTATGAAGCAGAAGGG + Intergenic
1182486375 22:30641438-30641460 CTGTCTGGCAGGCAGCAGACAGG - Intronic
1183150668 22:36034670-36034692 GTGTGTTCCAGGCAGGAGAAAGG - Intergenic
1183261495 22:36798578-36798600 CTGTGTGGAATGCAGGAGGAGGG - Intergenic
1183798392 22:40140405-40140427 CTGTGTTCCATGTAGCAGAAAGG - Intronic
1183798642 22:40142522-40142544 CTGTGTTCCGTGTAGCAGAAAGG + Intronic
1185024491 22:48400446-48400468 CTGTGTCCCATCCATCAGGAAGG + Intergenic
949494264 3:4617047-4617069 ATGTGTGCCCTATAGCAGAATGG + Intronic
951320064 3:21233721-21233743 GTGTGTGCCATGCAAAAGAAAGG - Intergenic
952824003 3:37509782-37509804 CTGTGAGCCATTCTGCAAAAGGG + Intronic
952854307 3:37755277-37755299 CAGTGTGCAATTCAGCACAATGG - Intronic
953754688 3:45636154-45636176 CTGTGTGAAATGCAGCAAAGGGG + Exonic
953846810 3:46434001-46434023 CTGTGTGCCACTCACCAGGATGG - Intergenic
954465090 3:50649582-50649604 CTGTGTGCCAGCCTGCTGAAGGG + Intergenic
955475757 3:59334235-59334257 CTAACTGCCATGCAGCAGACTGG + Intergenic
955683342 3:61525540-61525562 CTGTGTGCCAAGCAGCATGAGGG + Intergenic
956332970 3:68131647-68131669 CTGTGAGCCCTGCTGCAGAGGGG + Intronic
957852755 3:85831145-85831167 CTGTGTCCTTTGCAGCAGCATGG - Intronic
960378549 3:116932438-116932460 CTGGGTTCCAGGCAGGAGAAAGG - Intronic
961413432 3:126740305-126740327 CTGTGAGCAGTGCAGCAGAATGG - Intronic
962198405 3:133381953-133381975 CAGAGTGCCAGGCAGCAGCAAGG - Intronic
962602858 3:137007855-137007877 GTGTGAGCCATGCAGAAGATGGG - Intronic
963781998 3:149495694-149495716 CTGTGTGACTAGCAGCAGAGGGG - Intronic
965676612 3:171204085-171204107 CTGAATGGCATGCAGCAAAATGG + Intronic
966160100 3:176958705-176958727 CTGCATTCCAAGCAGCAGAATGG - Intergenic
967258099 3:187613696-187613718 CTGCCTGGCATGCAGCAGCAGGG + Intergenic
968641081 4:1715371-1715393 CTGTGGGTCAAGAAGCAGAATGG + Intergenic
970408099 4:15782867-15782889 CTGTGTGACAGGCAGGAGAGGGG - Intronic
970849371 4:20582963-20582985 CTGGGTGTGATGGAGCAGAATGG + Intronic
972282509 4:37616436-37616458 CTGTGTGGCAGGCAACAGAAAGG + Intronic
974029243 4:56761482-56761504 CTCTGTACCATTCAGAAGAATGG - Intergenic
975709082 4:77141153-77141175 TTGTGTGGCAGGCACCAGAATGG - Intergenic
975715655 4:77203402-77203424 CTGTGTCCCTAGCAGCAGCAGGG + Intronic
978807728 4:112818212-112818234 CTGTGAGTCACGCAGCAGGAGGG - Intronic
984558609 4:181241969-181241991 CTGTGTGCCCAGAAGGAGAAAGG + Intergenic
985200119 4:187476064-187476086 CTGGATGCCAGGCAGGAGAAAGG + Intergenic
985666818 5:1185667-1185689 CTGTGCACCATAGAGCAGAAGGG + Intergenic
986453750 5:7893847-7893869 CTCTGTTCCAGGCAGCAGACTGG - Intronic
987299096 5:16581015-16581037 CTGTGTGCCCTGCAGCTGCCAGG - Intronic
987377775 5:17252454-17252476 CTGTGTGCCATGCAGCAGAAAGG + Intronic
988282633 5:29170120-29170142 CTGTGTGCTGTCCAGCAGGAAGG - Intergenic
988536091 5:32070515-32070537 CTATATGCCATGAAGCAGAAGGG - Intronic
988965936 5:36417944-36417966 CCCTGTGGAATGCAGCAGAATGG + Intergenic
990615414 5:57502654-57502676 CTGTTTGCCATGCCCCAAAAAGG - Intergenic
991323338 5:65401453-65401475 TTGTGTTCCCAGCAGCAGAAGGG - Intronic
995767993 5:115639651-115639673 CTGTGTGCCAGGCAGTAGGTGGG - Intergenic
997301922 5:132813013-132813035 CTGTGTTTCATGCAGGAAAACGG - Intergenic
1002002945 5:176208316-176208338 CTCTGCCCCATGCAGCAGCATGG - Intergenic
1002223564 5:177702937-177702959 CTCTGCCCCATGCAGCAGCATGG + Intergenic
1003954020 6:11145640-11145662 CTGTATGTCATTCAGCACAAAGG + Intergenic
1005219601 6:23571794-23571816 ATGTGTCACATGCAGCAGAGAGG - Intergenic
1005885093 6:30091607-30091629 CTGGGGGCCATGCAGGATAAAGG + Intergenic
1006058387 6:31402482-31402504 ATGTGTGACATTCAGCAGATGGG + Intronic
1006070827 6:31497025-31497047 ATGTGTGACATTCAGCAGATGGG + Intronic
1006424032 6:33952719-33952741 CTGTGTTCGAGGCAGCAGGAAGG + Intergenic
1007113621 6:39328070-39328092 GTGTGTGCCTTGTAGTAGAAAGG + Intergenic
1007717580 6:43866167-43866189 CTGCCTGCCATGCAGGAGCAGGG + Intergenic
1009057624 6:58356120-58356142 CTGGGTGCCATGGAGGAGAGTGG + Intergenic
1009233198 6:61090964-61090986 CTGGGTGCCATGGAGGAGAGTGG - Intergenic
1013964867 6:115942973-115942995 GTAAGTGACATGCAGCAGAAAGG + Intronic
1014825891 6:126048066-126048088 CTTTGTTTCAGGCAGCAGAATGG - Intergenic
1016562807 6:145416011-145416033 CTCTGGGCCCTGCAGCTGAATGG + Intergenic
1016881721 6:148918016-148918038 ACATGTGCCATGCACCAGAAGGG + Intronic
1019702530 7:2480845-2480867 CTGTGTGCCACGCAGGAGGGCGG - Intergenic
1021513234 7:21456498-21456520 CTGTGTGCTTGGCAGCAGACAGG - Intronic
1021777750 7:24070297-24070319 CCATGTGCCAGGCAGGAGAAAGG - Intergenic
1023357372 7:39380916-39380938 CTGTGTGGCATTCAGGAGACAGG + Intronic
1024129539 7:46336550-46336572 CTATGTCCCATGCAGCAGGATGG + Intergenic
1024660496 7:51488326-51488348 ATGTTTGTGATGCAGCAGAAAGG + Intergenic
1024888688 7:54176589-54176611 CTGTGTCCCAGGGAGTAGAAAGG + Intergenic
1027555967 7:79665152-79665174 CTGTTACCAATGCAGCAGAAGGG + Intergenic
1031848305 7:126831765-126831787 GTGTGAGCCATGCAGAAGACAGG - Intronic
1032682629 7:134201237-134201259 TTGTGTGACATTCAGCAAAAGGG - Intronic
1034118531 7:148606256-148606278 CTATGTGCTAGGCATCAGAAGGG + Intronic
1035698529 8:1620391-1620413 GTGAGTGTCACGCAGCAGAAAGG - Intronic
1035987280 8:4448407-4448429 CTGTGTGCCCTGATGCAGATTGG + Intronic
1036686651 8:10916079-10916101 CTGTGAGCCATGGAGAAGGAGGG + Intronic
1038359257 8:26861134-26861156 CTGTGTCACATGCAGCTGAGAGG - Intronic
1039165848 8:34679374-34679396 CTGATTACCAGGCAGCAGAACGG - Intergenic
1041501219 8:58540750-58540772 CTATGTTCCAGACAGCAGAAAGG - Intergenic
1041982000 8:63872953-63872975 CTCTTTGCCAGGCAGCAGAAGGG - Intergenic
1043549097 8:81348786-81348808 CTGTGTTCCAGGCAGAAGGAAGG + Intergenic
1043861143 8:85318574-85318596 CTGTATGCCTTGCAGCATGAGGG + Intergenic
1045800233 8:106093525-106093547 CTGGATGCCATGAAGCAGAATGG + Intergenic
1046015470 8:108599498-108599520 CTGTGTGGCATCCAGTAGCAAGG - Intergenic
1046246104 8:111565176-111565198 CTCTGTGCAATGTAGCAGCAAGG - Intergenic
1048550916 8:135432991-135433013 CTGTGTGCTATGCAGAGGGAAGG - Intergenic
1048999151 8:139813711-139813733 ATGTGTGCAAGGCTGCAGAATGG + Intronic
1049175639 8:141190824-141190846 CTCTGTGCCAAGCAGCCGAGGGG - Intronic
1049358921 8:142202610-142202632 CTCTGTGCCATGCAGCCGAGGGG - Intergenic
1049360757 8:142211595-142211617 CTGGGTGGCAAGCAGCAGAGAGG + Intergenic
1050397022 9:5209622-5209644 CTATGTGCCCAGCAACAGAATGG + Intergenic
1051575520 9:18611122-18611144 CTGTATGCCCAGCAGCAGAAGGG + Intronic
1052349873 9:27447647-27447669 CAGTGTGCAAAGAAGCAGAAAGG - Intronic
1053611978 9:39723138-39723160 CTGTATACCATGCTGCAGAAGGG - Intergenic
1053614516 9:39749675-39749697 CTTTGTTCCAGGCAGCAGTAGGG - Intergenic
1053870016 9:42481132-42481154 CTGTATACCATGTTGCAGAAGGG - Intergenic
1053900208 9:42788303-42788325 CTTTGTTCCAGGCAGCAGTAGGG + Intergenic
1054086276 9:60748017-60748039 CTGTATACCATGCTGCAGAAGGG + Intergenic
1054239002 9:62592717-62592739 CTTTGTTCCAGGCAGCAGTAGGG + Intergenic
1054241541 9:62619255-62619277 CTGTATACCATGCTGCAGAAGGG + Intergenic
1054553131 9:66627239-66627261 CTTTGTTCCAGGCAGCAGTAGGG + Intergenic
1054555667 9:66653778-66653800 CTGTATACCATGCTGCAGAAGGG + Intergenic
1056130909 9:83585563-83585585 CTGTATTCCAGGCAGCAGGAAGG - Intergenic
1056277543 9:85007739-85007761 CTCTGTGACATGTAGCAGATGGG + Intronic
1056387494 9:86111236-86111258 CTATATTCCATTCAGCAGAAAGG + Intergenic
1056667838 9:88595971-88595993 CAGTGTGTCATGCGGCACAAAGG + Intergenic
1056694697 9:88837531-88837553 CTGGGTGCCATGATGAAGAAGGG - Intergenic
1057475109 9:95393119-95393141 CTGGGTGGGATGGAGCAGAAAGG - Intergenic
1057523298 9:95777721-95777743 CTGTGTTCCAGGCAGCAGAATGG + Intergenic
1057562228 9:96137743-96137765 CTGTGTGCCTTGCTCCAGCACGG + Intergenic
1058290597 9:103236222-103236244 CTGTGGGCAATGTAGCAGAGAGG + Intergenic
1059391492 9:114002217-114002239 CAGGGTGCCAGGCAGGAGAAGGG + Intronic
1059534993 9:115072231-115072253 CTGTGTTCTAGGCAGCATAAGGG - Intronic
1060258038 9:122049923-122049945 CTGTGTGCAATGCATCTGTAGGG + Intronic
1061004420 9:127920542-127920564 CAGTGTGCATTGCAGCTGAATGG + Intergenic
1061234872 9:129336535-129336557 CTGTGTGCCCTGTAGTAAAAGGG - Intergenic
1062002975 9:134226126-134226148 CTCTGGGCCATGGGGCAGAATGG - Intergenic
1062622506 9:137429189-137429211 CCCTGTGCCTTGGAGCAGAAGGG - Intronic
1185650543 X:1644881-1644903 CTGTGTGCCCTGCTGCAAATAGG + Intergenic
1187505775 X:19877067-19877089 CTGTGATCCATGAAGCAGGATGG - Intronic
1190128104 X:47723688-47723710 CTGTTTGCCATGCAGAATGATGG - Intergenic
1190556886 X:51644811-51644833 GTGTGAGCCATGCAGAAGACGGG + Intergenic
1192861392 X:75076056-75076078 GTGTGTCCCATGCATTAGAAAGG - Intronic
1193998429 X:88395520-88395542 CTGTGTGCCAGGCAGAAAGAAGG + Intergenic
1195924160 X:110009008-110009030 TTATATGCCATGCATCAGAAAGG - Intronic
1196789928 X:119455380-119455402 CTGTCAGCCATAAAGCAGAAAGG - Intergenic
1200898924 Y:8407840-8407862 CTGTGTTCCATGCAACAGCATGG + Intergenic
1201123996 Y:10895880-10895902 CTGAGTGCAATGCAGTGGAATGG - Intergenic
1201235710 Y:11908902-11908924 CTGTGGGCCCTGGAGGAGAAAGG + Intergenic
1201584659 Y:15547262-15547284 CTGAGAGCCATGCAGCATCAAGG + Intergenic
1201963897 Y:19710386-19710408 CCCTGTGCCATGCATCAGATTGG - Exonic