ID: 987379522

View in Genome Browser
Species Human (GRCh38)
Location 5:17272013-17272035
Sequence GTGCAGCAGCAGCACAATCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 657
Summary {0: 2, 1: 2, 2: 17, 3: 61, 4: 575}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987379522 Original CRISPR GTGCAGCAGCAGCACAATCT CGG (reversed) Intronic
901302122 1:8207391-8207413 GGAATGCAGCAGCACAATCTCGG - Intergenic
901353951 1:8626422-8626444 GAGCAGGAGCATCACCATCTTGG + Intronic
901425185 1:9178226-9178248 GTGCAGCAGTGGCATGATCTCGG + Intergenic
901552140 1:10003372-10003394 GTGCAATGGCAGCACGATCTTGG - Intronic
901573444 1:10180724-10180746 GAGCAGCTGCAGCAAAATCTAGG + Exonic
901603119 1:10437811-10437833 GGAGAGCAGCAGCTCAATCTCGG + Intronic
902472241 1:16657053-16657075 CTGCAGCCGCTGCACAAGCTGGG + Intergenic
902486562 1:16750393-16750415 CTGCAGCCGCTGCACAAGCTGGG - Intronic
902504400 1:16930003-16930025 CTGCAGCCGCTGCACAAGCTGGG - Exonic
902766071 1:18616258-18616280 GTGGTGCAGTGGCACAATCTCGG - Intergenic
903718303 1:25385737-25385759 AAGCACCAGCAGCACAATGTAGG + Exonic
904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG + Intergenic
904652875 1:32019042-32019064 GTGCAGTGGCGGCGCAATCTCGG - Intronic
904739582 1:32662931-32662953 GTGCAGTAGTAGCACGATCTCGG - Intronic
905113085 1:35611771-35611793 GTGGTGCAGTAGCACTATCTCGG - Intronic
905142781 1:35861499-35861521 GGAGTGCAGCAGCACAATCTTGG - Intergenic
905272683 1:36797150-36797172 GGGCTGCAGCAGCAAAGTCTGGG - Exonic
905534398 1:38708949-38708971 GAGCAGCAGCAGCAGCATCGCGG - Intergenic
906234858 1:44200112-44200134 GTGGTGCAGTGGCACAATCTTGG + Intergenic
906968568 1:50485609-50485631 GTGGTGCAGTAGCACAATCTCGG - Intronic
906995448 1:50788880-50788902 GGACAGCAGTGGCACAATCTTGG + Intronic
907000308 1:50846071-50846093 ATGCAGTAGTGGCACAATCTTGG - Intronic
907041293 1:51262596-51262618 GGAGTGCAGCAGCACAATCTTGG + Intronic
907121335 1:52010743-52010765 GTAGAGCAGTGGCACAATCTCGG + Intergenic
907162140 1:52378611-52378633 GGAGTGCAGCAGCACAATCTTGG - Intronic
907399111 1:54213510-54213532 ATGCAGCAGGTGCTCAATCTGGG - Intronic
908539182 1:65106401-65106423 GTGCAGCAGCAGTATCACCTGGG - Intergenic
908718059 1:67091066-67091088 GAGCAGCAGCAGCGCGATCTCGG - Intergenic
908959625 1:69680116-69680138 CAGCAGCAGCAGCAGCATCTGGG + Intronic
909342999 1:74552359-74552381 GTGCAGGGGCAGCAAGATCTCGG - Intergenic
909942296 1:81624529-81624551 GTGGGGCAGTGGCACAATCTTGG - Intronic
911110553 1:94179540-94179562 GGGGTGCAGCAGCACAATCTCGG - Intronic
911311531 1:96297864-96297886 GTGCAGCAGCAGCAGAGTAATGG + Intergenic
911331960 1:96534985-96535007 GTGCAGGAGCAGGACATTTTGGG + Intergenic
911779020 1:101851961-101851983 TTGCAGCATCAGCATCATCTGGG - Intronic
912334472 1:108849426-108849448 GGAGTGCAGCAGCACAATCTTGG - Intronic
912602112 1:110946708-110946730 GTGCAGTAGTGGCACAATCTTGG + Intergenic
912788331 1:112625884-112625906 GTCCAGTACCAGCACATTCTTGG + Intronic
915499470 1:156305111-156305133 GGAACGCAGCAGCACAATCTTGG - Intergenic
915735198 1:158080202-158080224 GGGCAGCAGTAGCACCTTCTAGG - Intronic
916577714 1:166082057-166082079 TTGCAGGGGCAGCACAAGCTTGG - Intronic
918418390 1:184336432-184336454 GTGCAGCAGTGGCACAATCTTGG - Intergenic
919004301 1:191874942-191874964 GGAGTGCAGCAGCACAATCTTGG - Intergenic
920317699 1:205090708-205090730 TTCCAGTAGCAGCCCAATCTAGG + Intronic
922321998 1:224496587-224496609 GTGAAGCAGCAGCACCTTCCTGG - Intronic
922417346 1:225433472-225433494 GGAGTGCAGCAGCACAATCTCGG - Intergenic
922863641 1:228840316-228840338 GTGGTGCAGTGGCACAATCTCGG - Intergenic
923073091 1:230583661-230583683 GGAGTGCAGCAGCACAATCTTGG + Intergenic
923102688 1:230828874-230828896 GTAGTGCAGCGGCACAATCTCGG + Intergenic
923506290 1:234609196-234609218 TTGCAGCAGCAGCAGCAGCTTGG - Exonic
923596082 1:235361664-235361686 GTGCAGTAGTGGCACTATCTTGG + Intergenic
923672281 1:236051030-236051052 GTGCATCATCAGTGCAATCTCGG - Intronic
1062952130 10:1512371-1512393 GTGTAGCAGCATCAGCATCTTGG - Intronic
1062972680 10:1660825-1660847 GAGCAGGAGCATCACCATCTTGG + Intronic
1064055260 10:12091853-12091875 GTAGTGCAGCAGCACGATCTTGG + Intronic
1064697149 10:17978891-17978913 GGGCAGCAGCAGTACCACCTGGG + Intronic
1065383752 10:25114621-25114643 GGAGTGCAGCAGCACAATCTTGG + Intergenic
1065683445 10:28260719-28260741 GGAGTGCAGCAGCACAATCTTGG - Intronic
1066719138 10:38319069-38319091 GTAGAGCAGTGGCACAATCTCGG - Intergenic
1067208595 10:44240201-44240223 GTGCAGTAGCTGTACCATCTAGG + Intergenic
1067250765 10:44584918-44584940 GTGTAGCAGATGCACCATCTAGG - Intergenic
1067327954 10:45287538-45287560 GAGCAGGAGCATCACCATCTTGG - Intergenic
1068518761 10:58056288-58056310 GGAGTGCAGCAGCACAATCTCGG + Intergenic
1069712318 10:70497615-70497637 GTGCAGTAGTAGCGCGATCTCGG + Intronic
1070426460 10:76293017-76293039 GTAATGCAGCAGCACAATCTCGG + Intronic
1071341588 10:84653745-84653767 GTGGTGCAGTGGCACAATCTCGG + Intergenic
1071813300 10:89206915-89206937 GTGCAGCAGCAGGAGCAGCTCGG + Exonic
1072115003 10:92362295-92362317 GGGGTGCAGCAGCACGATCTCGG + Intergenic
1072440801 10:95453233-95453255 GGACTGCAGTAGCACAATCTTGG - Intronic
1072540885 10:96397213-96397235 CCGCAGCAGCAGCAACATCTTGG - Exonic
1073796492 10:106994008-106994030 GTGCTGCAGTGGCACAACCTTGG - Intronic
1074182510 10:111077029-111077051 GAGCAGCAGCAGCTCCAGCTCGG + Intergenic
1074638735 10:115352847-115352869 GTGCAATGGCACCACAATCTCGG - Intronic
1074817239 10:117151664-117151686 GGAGTGCAGCAGCACAATCTCGG - Intergenic
1074979248 10:118606439-118606461 GGGCAGCAGCAGCAGCATCTGGG + Intergenic
1075539423 10:123299748-123299770 GTGCAGCAGAGGCCCAATCCCGG + Intergenic
1075701457 10:124472260-124472282 GGGGTGCAGTAGCACAATCTTGG - Intronic
1076141509 10:128082262-128082284 GTGGTGCAGTGGCACAATCTTGG + Intronic
1076791569 10:132779480-132779502 TGGCAGCGGCAGCACAATGTGGG - Intronic
1077064629 11:635494-635516 GGAGTGCAGCAGCACAATCTTGG - Intergenic
1077114369 11:876683-876705 GTGCAGCGTCAGCACTCTCTCGG + Intronic
1077277981 11:1725617-1725639 GTGCAGTGGCACCACCATCTCGG - Intergenic
1077765749 11:5158327-5158349 GTGCAGTGGCAGCACAATCTTGG + Intronic
1077930297 11:6724274-6724296 GTTTAGCAGCAGCACATTGTAGG + Intergenic
1078076671 11:8168656-8168678 TTCCAGCAGCAGAACCATCTGGG + Intronic
1078136295 11:8654909-8654931 GGACTGCAGCGGCACAATCTCGG + Intronic
1078595012 11:12678350-12678372 GCCCAGCAGCAGCACAGCCTAGG - Intronic
1078636933 11:13060196-13060218 GTGCAGCAGTGCCACGATCTTGG - Intergenic
1080882314 11:36333973-36333995 GTGCAGGAGCAGCACAAAAAGGG - Intronic
1081093254 11:38899614-38899636 TAGCAGTAGCAGCACAATTTAGG + Intergenic
1081095366 11:38926149-38926171 GTGCAGCAGCGGCGCGATCTCGG - Intergenic
1081644688 11:44781496-44781518 GTGCAGTAGCAGCACATAGTAGG + Intronic
1081907756 11:46680204-46680226 GTGCAGCAGAAGTACAACATGGG - Exonic
1082004553 11:47412363-47412385 CTGCAGCAGCAGCAACAGCTGGG + Exonic
1082099548 11:48161125-48161147 GTGCAGCAGTGGCACAATCTCGG - Intronic
1082878901 11:58018463-58018485 CTGCAGCAGCAGCATCACCTGGG - Intergenic
1083164179 11:60873477-60873499 GTGCAGCAGCAGGACCAGGTTGG - Exonic
1083338082 11:61938873-61938895 GGAGAGCAGTAGCACAATCTTGG - Intergenic
1083851310 11:65369040-65369062 CAGCAGCAGCAGCAGCATCTGGG + Intergenic
1084151659 11:67290352-67290374 GAGCACCAGCTGCACCATCTCGG - Exonic
1084272324 11:68035966-68035988 GGAGTGCAGCAGCACAATCTCGG - Intronic
1085006533 11:73096498-73096520 GGAGTGCAGCAGCACAATCTCGG - Intronic
1085099801 11:73790934-73790956 GTAGTGCAGTAGCACAATCTTGG + Intronic
1085151646 11:74257173-74257195 GGAGTGCAGCAGCACAATCTTGG + Intronic
1085171839 11:74456279-74456301 GTGGTGCAGCAACCCAATCTTGG - Exonic
1085497208 11:76980624-76980646 GTGCAGTAGCAGCACAATCGTGG - Intronic
1086571114 11:88285638-88285660 GTGTAGCAGGAGCACAATGATGG + Intergenic
1087418659 11:97891691-97891713 GGGGTGCAGCGGCACAATCTCGG + Intergenic
1088142004 11:106628459-106628481 GAGCAGGAGCATCACCATCTTGG - Intergenic
1088391386 11:109318786-109318808 GTGCAGCAGCAGTCCATTTTTGG - Intergenic
1088846087 11:113669382-113669404 GAGCAGCATCAGCACCACCTGGG + Intergenic
1090931129 11:131299069-131299091 CAGCAGCAGCAGCACCACCTGGG - Intergenic
1090956919 11:131521457-131521479 GTGCAGTGGCGGCGCAATCTCGG + Intronic
1091465534 12:680781-680803 GTGCTGCAGTGGCACAATCTCGG - Intergenic
1091736298 12:2924801-2924823 GGAATGCAGCAGCACAATCTTGG - Intronic
1092825274 12:12393182-12393204 GGAGTGCAGCAGCACAATCTCGG - Intronic
1093060782 12:14601069-14601091 GTGTTGCAGTGGCACAATCTGGG + Intergenic
1093170851 12:15858792-15858814 CTGTAGCAGCAGCAGAATCCAGG + Intronic
1093763841 12:22939989-22940011 GTGCAGCAGCAGCACAATCTTGG + Intergenic
1093933215 12:24975036-24975058 GGAGTGCAGCAGCACAATCTTGG + Intergenic
1094468866 12:30784246-30784268 GAGCAGGAGCATCACCATCTTGG + Intergenic
1095436391 12:42193262-42193284 GGGGTGCAGCAGCGCAATCTCGG - Intronic
1096109374 12:49020104-49020126 GTTCAACTGCAGCACAAGCTTGG + Exonic
1096111836 12:49033459-49033481 CAGCAGCAGCAGCACCTTCTAGG - Exonic
1096170673 12:49467097-49467119 GGAGTGCAGCAGCACAATCTCGG + Intronic
1096654916 12:53083420-53083442 GTGCAGTGGCAGCACAACCATGG - Intergenic
1096855575 12:54479837-54479859 GCCCAGCAGTGGCACAATCTCGG + Intergenic
1097111998 12:56666968-56666990 GGAGTGCAGCAGCACAATCTCGG + Intronic
1097113747 12:56681893-56681915 GTGCAGCAGTGGCGCATTCTCGG + Intronic
1097643738 12:62211527-62211549 GGAGTGCAGCAGCACAATCTTGG - Intronic
1098000154 12:65932778-65932800 GTGCAGCAACAGGACTCTCTGGG + Intronic
1099163530 12:79274554-79274576 GGGCAGCCGCAGCGCAAACTTGG + Intronic
1099218034 12:79877564-79877586 GGAGTGCAGCAGCACAATCTCGG + Intronic
1099316861 12:81094923-81094945 GAGCAGCAGCAGCACGATGCAGG - Intronic
1099454035 12:82843135-82843157 GTCTCGCAGTAGCACAATCTCGG + Intronic
1100446406 12:94664288-94664310 GGACAGCAGTGGCACAATCTCGG - Intergenic
1100898212 12:99209690-99209712 GAGCAGGAGCATCACCATCTTGG + Intronic
1101143203 12:101817316-101817338 GTGGAGCAGTGGCACAATCATGG + Intronic
1101269727 12:103130811-103130833 TTGCAGCAGCAGCAGAAAATTGG - Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1101782506 12:107848471-107848493 GAGCAGAAGCATCACCATCTTGG + Intergenic
1102340685 12:112119264-112119286 GTGCAGTGGCGGCACAATCTCGG - Intergenic
1102977622 12:117217923-117217945 CAGCAGCATCAGCACCATCTGGG - Intronic
1103132400 12:118480614-118480636 GAGCAGGAGCATCACCATCTTGG - Intergenic
1103133670 12:118489455-118489477 GAGCAGGAGCATCACCATCTTGG - Intergenic
1103316442 12:120059760-120059782 GTGCAGTGGCAGCACGATCATGG + Intronic
1103368427 12:120400205-120400227 GGAGAGCAGCAGCACGATCTTGG + Intergenic
1103384526 12:120521623-120521645 GTGCAGCAGCGGTGCAATCTCGG - Intronic
1103473052 12:121197461-121197483 GCAGTGCAGCAGCACAATCTCGG + Intergenic
1103566833 12:121820288-121820310 GTGCAGCAGCATCACGATGCCGG - Intronic
1104209577 12:126675632-126675654 GTTCAGCAGCAGCAACATGTAGG + Intergenic
1105373363 13:19820308-19820330 GAAGTGCAGCAGCACAATCTTGG + Intergenic
1105983913 13:25547077-25547099 GGAGGGCAGCAGCACAATCTTGG - Intronic
1106406958 13:29482858-29482880 CTGCAGCAGGAGCAGAATCAGGG - Intronic
1106690619 13:32111443-32111465 GGAGTGCAGCAGCACAATCTCGG - Intronic
1107209355 13:37834776-37834798 GGAGTGCAGCAGCACAATCTCGG + Intronic
1108336831 13:49452160-49452182 GTAGTGCAGTAGCACAATCTTGG + Intronic
1108356355 13:49631784-49631806 GGAGTGCAGCAGCACAATCTCGG - Exonic
1110760773 13:79228120-79228142 GTGCAGGAGCAGGGCACTCTAGG - Intergenic
1111065297 13:83083540-83083562 GGGCAGGAGCATCGCAATCTTGG + Intergenic
1111851100 13:93575524-93575546 ATGGACCAGCAGCATAATCTGGG - Intronic
1112386997 13:98949121-98949143 GGACCGCAGCAGCACAATCATGG + Intronic
1112411816 13:99171167-99171189 GGGGAGCAGTGGCACAATCTCGG + Intergenic
1113172222 13:107517579-107517601 GTGCAGCAGTGGCGCGATCTTGG - Intronic
1113743556 13:112727096-112727118 GGAGTGCAGCAGCACAATCTGGG + Intronic
1113785851 13:113001819-113001841 GCGCAGCACCAGCACCATCTTGG - Intronic
1113845549 13:113388097-113388119 GGAATGCAGCAGCACAATCTTGG + Intergenic
1114839494 14:26246809-26246831 GTAGTGCAGCAGCACAATCTCGG - Intergenic
1114935886 14:27535677-27535699 GTGCAGCAGCACCCCATTTTTGG + Intergenic
1115064810 14:29244740-29244762 GTGCAGTGGCAGCGCTATCTTGG - Intergenic
1115279675 14:31647575-31647597 GTTCAGCAGCACCACATTGTAGG - Intronic
1115631738 14:35252370-35252392 GTGCAGCAGTGGCACAAACATGG - Intronic
1115749425 14:36474287-36474309 GTACAGCAGTGGCACCATCTTGG + Intronic
1115862298 14:37700690-37700712 GGGATGCAGTAGCACAATCTTGG - Intronic
1116875619 14:50108136-50108158 GTGCAGTAGTGGCACAATCTTGG - Intergenic
1118189581 14:63568437-63568459 GTGCAGCAGTGGCACAATCTCGG + Intergenic
1118749316 14:68794955-68794977 GGGCAGCAGCAGAACAAGCGAGG - Intronic
1118962162 14:70543863-70543885 GAGCAGGAGCATCACCATCTTGG + Intergenic
1119043214 14:71294444-71294466 GTGCAGCAGTGGCACAATCTTGG + Intergenic
1119728531 14:76936828-76936850 GTAGTGCAACAGCACAATCTCGG + Intergenic
1120007940 14:79381035-79381057 GTCCAGTAGCAGCACCATCCAGG - Intronic
1120105631 14:80490996-80491018 CTGCAGCAGCAGTATTATCTGGG - Intronic
1120894162 14:89514968-89514990 GGAGTGCAGCAGCACAATCTCGG + Intronic
1121021093 14:90580602-90580624 GTGCAGAAGCAGCACTAGCAAGG - Intronic
1122608874 14:102967553-102967575 GTGCGGCAGCCGCACCGTCTAGG - Intronic
1122851294 14:104533111-104533133 GGACTGCAGCGGCACAATCTCGG - Intronic
1123486085 15:20740353-20740375 GTAGAGCAGTGGCACAATCTTGG - Intergenic
1123542577 15:21309422-21309444 GTAGAGCAGTGGCACAATCTTGG - Intergenic
1123760238 15:23426177-23426199 GGAATGCAGCAGCACAATCTCGG - Intergenic
1124165556 15:27322761-27322783 GGGCATCAGCAGCAGAGTCTGGG - Intronic
1124721913 15:32117827-32117849 GAGCACCAGCAGGCCAATCTCGG - Intronic
1125791436 15:42369357-42369379 GAGCAGGAGCATCACCATCTTGG - Intronic
1126804402 15:52331753-52331775 ATGCTGCAGCAGCACACACTGGG + Intronic
1127428580 15:58880435-58880457 CAGCAGCAGCAGCACCAGCTGGG + Intronic
1127500260 15:59548320-59548342 GAGCAGGAGCATCACCATCTTGG + Intergenic
1128019420 15:64377414-64377436 GTGCAGTGGCGGCGCAATCTTGG - Intronic
1128333908 15:66773972-66773994 GTGAAGCAGCAGCAAAGACTTGG + Intronic
1129607095 15:77030314-77030336 GAGCAGCAGCAGCACCAGCGTGG + Intronic
1130059335 15:80558388-80558410 GTGCAGTAGTGGCACAATCTCGG + Intronic
1130585704 15:85180247-85180269 GGGCAGTGGCATCACAATCTTGG + Intergenic
1131142921 15:89992301-89992323 ATGCAGCAGCAGCACCATCTGGG - Intergenic
1131505756 15:93017374-93017396 GTGTAGCGGCGGCACGATCTTGG + Intronic
1202950894 15_KI270727v1_random:36563-36585 GTAGAGCAGTGGCACAATCTTGG - Intergenic
1134386694 16:13780104-13780126 GTGAAGCAGCATCACTGTCTGGG - Intergenic
1134675150 16:16085206-16085228 GTGAAGCAGCAGGAAAACCTGGG - Intronic
1135810644 16:25583778-25583800 GAGCAGGAGCATCACCATCTTGG + Intergenic
1136100221 16:27989000-27989022 GGAGTGCAGCAGCACAATCTCGG - Intronic
1136317368 16:29462180-29462202 GTGCAGCAGCAGGATCATCAGGG - Intronic
1136424118 16:30157705-30157727 GGAGTGCAGCAGCACAATCTCGG + Intergenic
1136431943 16:30201523-30201545 GTGCAGCAGCAGGATCATCAGGG - Intronic
1136495710 16:30642541-30642563 GGACTGCAGCAGCACGATCTTGG + Intergenic
1137237377 16:46626656-46626678 GATCAGCAGCTGCACAATGTTGG + Intergenic
1138030447 16:53555624-53555646 GGAGTGCAGCAGCACAATCTTGG - Intergenic
1138166654 16:54808118-54808140 CAGCAGCAGCAGCAGCATCTGGG - Intergenic
1138206874 16:55131742-55131764 CTGCAGCAGCAGCATTACCTGGG + Intergenic
1138224456 16:55280874-55280896 GTCCAGCTGCAGCACACCCTGGG - Intergenic
1138812591 16:60168189-60168211 ATGCAGTAGCAGCATCATCTGGG - Intergenic
1138826445 16:60326336-60326358 GTGGTGCAGTGGCACAATCTTGG + Intergenic
1138833802 16:60409024-60409046 GTGCAGCAGTGGTGCAATCTCGG + Intergenic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1139308002 16:66004445-66004467 GGGCATCACCAGCACCATCTTGG + Intergenic
1139534895 16:67565620-67565642 GGAGTGCAGCAGCACAATCTCGG - Intronic
1139618393 16:68115473-68115495 GTGCAGTAGTAGCGCAATCTCGG + Intronic
1139628237 16:68209314-68209336 GTGCAGTAGCATCCCAATCACGG - Intronic
1139629986 16:68224626-68224648 GGGCTGCAGTGGCACAATCTCGG + Intronic
1139829454 16:69785180-69785202 GTGGTACAGTAGCACAATCTCGG - Intronic
1139937240 16:70580118-70580140 GTGAAGCAGCAGCAGAATCGGGG - Intronic
1141103963 16:81217790-81217812 GTGCAGTGGCGGCACCATCTTGG - Intergenic
1141239090 16:82248458-82248480 GTGCAGAAGCAGCAAGATGTGGG + Intergenic
1142725872 17:1813469-1813491 GTGCAGCACTGGCACGATCTCGG + Intronic
1142957758 17:3532876-3532898 CATCAGCAGCTGCACAATCTCGG + Exonic
1143226815 17:5312198-5312220 GTGCAGTGGCACAACAATCTTGG + Intronic
1143458800 17:7086597-7086619 GTGCAGTGGCAGCGCTATCTTGG + Intergenic
1144320448 17:14112842-14112864 GTGTAGCAGAAGCACAAGTTTGG + Intronic
1144570425 17:16394652-16394674 GTGCAGCGGTGGCACTATCTCGG + Intergenic
1144572887 17:16411278-16411300 GTGCAGCGGTGGCACTATCTCGG + Intergenic
1144583696 17:16474940-16474962 GTGCAGCGGTGGCACAATCTTGG - Intronic
1146095512 17:29926501-29926523 GGAGTGCAGCAGCACAATCTCGG - Intronic
1146228897 17:31091629-31091651 GGATTGCAGCAGCACAATCTAGG + Intergenic
1146311784 17:31774711-31774733 GTGGTGCAGTGGCACAATCTTGG - Intergenic
1147340564 17:39751164-39751186 GACCAGCAGCAGCCCATTCTTGG + Intergenic
1148632522 17:49122275-49122297 GAGCAGGAGCATCACCATCTTGG - Intergenic
1149681677 17:58512035-58512057 GGACAGCAGTGGCACAATCTCGG + Intronic
1150289441 17:63973024-63973046 GTGCAGCAGCAGCACCTTGCAGG - Intergenic
1150877022 17:68981773-68981795 GTGGTGCAGTGGCACAATCTCGG - Intronic
1151323936 17:73367551-73367573 GTGCAGCAGTAGCACAATCTCGG + Intronic
1151551943 17:74827344-74827366 GGAGTGCAGCAGCACAATCTCGG + Intronic
1152542167 17:80981860-80981882 GTCCAGCACCAGCACTTTCTGGG + Intergenic
1152595300 17:81234846-81234868 GAGCAGGAGCATCACCATCTTGG + Intronic
1152733374 17:81984524-81984546 GTGCAGTGGCAGCACAATCTCGG - Intronic
1152854782 17:82658522-82658544 ATGCCGCAGCAGCACGATCCTGG + Exonic
1152880226 17:82810387-82810409 GTGCAGCAGTGGCACCATCATGG - Intronic
1153888181 18:9486341-9486363 GTGCAGTAGTAGCACGATCTTGG + Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155496380 18:26446959-26446981 GTGCAGCAGTAGCACAATCATGG - Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1157058711 18:44260969-44260991 TTGCAGCAGCAGAACAATTTGGG + Intergenic
1157741534 18:50097593-50097615 CTGCAGCAGCAGCAGAATGTAGG + Intronic
1157836887 18:50912278-50912300 GTGCAGAAGCAGCACAAAAAAGG - Intronic
1158711620 18:59842778-59842800 GTGCTGCAGTGGCACGATCTCGG - Intergenic
1158917468 18:62150030-62150052 GGAGTGCAGCAGCACAATCTTGG + Intronic
1159186582 18:64983640-64983662 GTGGATCAGGAGCAGAATCTGGG - Intergenic
1160779829 19:872787-872809 GGGCAGCAGCAGCAGAAGCAAGG + Intronic
1160880636 19:1318430-1318452 GGACAGCAGCAGCACAATCTTGG - Intergenic
1161061342 19:2216687-2216709 GTGCCGCCTCAGCACAATCTTGG - Exonic
1161234704 19:3192135-3192157 GGAGTGCAGCAGCACAATCTCGG - Intronic
1161908699 19:7176548-7176570 GGGCTGCAGTGGCACAATCTCGG - Intronic
1161910648 19:7191244-7191266 TTCCAGCAGTGGCACAATCTCGG - Intronic
1162342155 19:10097800-10097822 GGGCTGCAGTGGCACAATCTCGG - Intronic
1162740536 19:12771194-12771216 TTGCAGCAGCAGCAGCTTCTTGG + Exonic
1163140878 19:15347707-15347729 GTGCAGTGCCAGCATAATCTTGG - Intergenic
1163224293 19:15945036-15945058 GAGCAGGAGCATCACTATCTTGG - Intergenic
1163265580 19:16218684-16218706 TTGGAGCAGGAGCAAAATCTAGG + Intronic
1163416498 19:17190012-17190034 GGGCTGCAGTGGCACAATCTTGG - Intronic
1163422756 19:17223919-17223941 GTGGTACAGCAGCACAATCGTGG + Intergenic
1163454648 19:17399330-17399352 GTGGAGCAGCAGCATAGTCTGGG + Intergenic
1163954232 19:20620602-20620624 GGAGTGCAGCAGCACAATCTTGG + Exonic
1165241265 19:34470206-34470228 GAGTAGCAATAGCACAATCTTGG - Exonic
1165542948 19:36507216-36507238 GGAGTGCAGCAGCACAATCTAGG - Intergenic
1165561322 19:36682656-36682678 GGGGAGCAGCGGCACCATCTTGG + Intergenic
1165703448 19:37956532-37956554 TTGGAGCAGTGGCACAATCTCGG + Intronic
1165993609 19:39829923-39829945 CAGCAGCCGCAGCTCAATCTGGG + Exonic
1166076853 19:40418744-40418766 GGAGTGCAGCAGCACAATCTCGG + Intergenic
1166292884 19:41874411-41874433 GTGCAGTGGCGGCACAATCTTGG - Intergenic
1166589608 19:43985110-43985132 GTGCAGCAGTGGCGCGATCTTGG + Intronic
1166698172 19:44866119-44866141 GTGCAGTGGTGGCACAATCTCGG - Intronic
1166962662 19:46508167-46508189 GTGCAGCAGTGGCACGATCTTGG - Intronic
1167034030 19:46982715-46982737 CAGCAGCAGCAGCATCATCTGGG + Intronic
1167845559 19:52161411-52161433 GTGCAGCAACAAGACCATCTTGG - Intronic
1202704637 1_KI270713v1_random:13847-13869 CTGCAGCCGCTGCACAAGCTGGG + Intergenic
925087258 2:1117783-1117805 GTGCAGCAGCAGCAAAGACCCGG - Intronic
925780778 2:7380000-7380022 GCGCAGCAGGGGCACCATCTAGG + Intergenic
925992314 2:9263393-9263415 GCACAGCAGCAGCACAAACACGG - Intronic
926114334 2:10202796-10202818 GAGCAGGAGCATCACCATCTTGG - Intronic
926155697 2:10452745-10452767 GTGGTGCAGTGGCACAATCTTGG + Intergenic
927685056 2:25164747-25164769 GAGCGGCTGCAGCACGATCTCGG + Exonic
927909691 2:26888319-26888341 GTGCAGTAGTAGTGCAATCTGGG + Intronic
928560960 2:32484498-32484520 GGACTGCAGCAGCACGATCTTGG - Intronic
928929514 2:36610040-36610062 GTACATCAACAGCACAATGTAGG - Intronic
929471091 2:42193734-42193756 GTTGTGCAGCAGCACAATCATGG + Intronic
929763864 2:44828183-44828205 GTGCAGTAGTGGCACAAGCTTGG + Intergenic
929930376 2:46251123-46251145 GCGGTGCAGTAGCACAATCTCGG + Intergenic
930041323 2:47127317-47127339 GGAGCGCAGCAGCACAATCTTGG + Intronic
931472197 2:62549536-62549558 GTGCAGCAATGGCACCATCTTGG + Intergenic
931662419 2:64578606-64578628 GTGCAGTAGTGGCACGATCTCGG + Intronic
931735108 2:65186764-65186786 GTGCTGCAGTGGCGCAATCTCGG + Intergenic
932688175 2:73891295-73891317 GTGCAGCAGCAGCATGATATGGG - Intergenic
933620863 2:84539684-84539706 GAGCAGCATGAGCACAATGTGGG - Intronic
933819035 2:86092772-86092794 GGAGTGCAGCAGCACAATCTTGG - Intronic
933883383 2:86694610-86694632 GGAGAGCAGTAGCACAATCTCGG - Intronic
933913704 2:86966878-86966900 GTGCTGCAGTGGCACGATCTCGG - Intronic
934009290 2:87803020-87803042 GTGCTGCAGTGGCACGATCTCGG + Intronic
935640997 2:105290115-105290137 GTGGTGCAGTGGCACAATCTTGG + Intronic
935772872 2:106443744-106443766 GTGCTGCAGTGGCACGATCTCGG + Intronic
935907197 2:107852188-107852210 GTGCTGCAGTGGCACGATCTCGG - Intronic
936085719 2:109467547-109467569 CTGCAGCAGCCCCACCATCTGGG - Intronic
936087289 2:109477900-109477922 GTGCAGCAGCCCCACACCCTTGG + Intronic
936128987 2:109817337-109817359 GTGCTGCAGTGGCACGATCTCGG - Intronic
936215710 2:110554148-110554170 GTGCTGCAGTGGCACGATCTCGG + Intronic
936424847 2:112408720-112408742 GTGCTGCAGTGGCACGATCTCGG + Intronic
936628826 2:114178033-114178055 CTGCAGCAGCAGCATCTTCTGGG - Intergenic
936781624 2:116039827-116039849 CAGCAGCAGCAGCAGCATCTGGG - Intergenic
937051447 2:118894626-118894648 GTGCAGAAGCAGCAAGCTCTTGG - Intergenic
937054610 2:118923356-118923378 GAGCAGGAGCATCACCATCTTGG + Intergenic
937303023 2:120854860-120854882 CAGCAGCAGCAGCAGCATCTGGG - Intronic
938312765 2:130303981-130304003 GGACTGCAGTAGCACAATCTCGG - Intergenic
938656611 2:133441123-133441145 GAGCAGCAGCAGCATTGTCTAGG + Intronic
938662289 2:133499608-133499630 GGAGTGCAGCAGCACAATCTTGG + Intronic
939072769 2:137563324-137563346 GTGGAGGAGGAACACAATCTAGG + Exonic
939388782 2:141538688-141538710 GTGCAGCAGCACAATGATCTTGG + Intronic
939396678 2:141639465-141639487 GTGCAGCAGTGGCATGATCTTGG + Intronic
941040809 2:160621003-160621025 GATCAGCAGCAGCTCAATCCAGG + Intergenic
942139780 2:172966459-172966481 GAGCAGCAGCAGCAGCATCTGGG - Intronic
942330278 2:174816379-174816401 ATGCTGCAGCAGCAGAGTCTAGG - Intronic
943545113 2:189266373-189266395 GGAGTGCAGCAGCACAATCTCGG - Intergenic
943931214 2:193855943-193855965 GGAGTGCAGCAGCACAATCTCGG - Intergenic
944061829 2:195577917-195577939 GGACAGAAGCACCACAATCTTGG + Intronic
944241721 2:197492239-197492261 GGGGTGCAGCAGCACAATCTCGG + Intronic
944669672 2:201984511-201984533 GTGCAACAGCTGCACAGCCTTGG + Intergenic
946668136 2:222072792-222072814 GTGCAGCAATGGCACGATCTCGG - Intergenic
947179712 2:227401247-227401269 GTGCAGTGGTGGCACAATCTCGG - Intergenic
947225240 2:227833280-227833302 GTGCAGTGGTGGCACAATCTTGG - Intergenic
1169507253 20:6224800-6224822 GTGGTGCAGTGGCACAATCTTGG + Intergenic
1169902958 20:10571432-10571454 GTGAGACAGCAGCACACTCTGGG - Intronic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1171070928 20:22067890-22067912 CAGCAGCATCAGCACCATCTGGG - Intergenic
1171179347 20:23081199-23081221 GTTCAGCAGCAGAACAAGCCAGG - Exonic
1171217789 20:23364848-23364870 GGGCAGGAGCAGCACTAACTTGG - Exonic
1171217924 20:23365636-23365658 GTGCAGCCGCAGCGCTGTCTTGG - Exonic
1171450317 20:25231191-25231213 GGAGTGCAGCAGCACAATCTTGG - Intergenic
1172555853 20:35840661-35840683 CAGCAGCAGCAGCAACATCTGGG + Intronic
1172563343 20:35908448-35908470 CTGAAGCAGCAACATAATCTAGG - Intronic
1173168685 20:40704723-40704745 GGGCAACAGCAGCCCCATCTTGG - Intergenic
1173620332 20:44431312-44431334 GTGCAGCCTCAGGCCAATCTTGG - Exonic
1173799299 20:45884959-45884981 GTGCAGTGGCAGCAGGATCTTGG - Exonic
1173816691 20:45993876-45993898 GTTCAGCAGGAGCACTACCTGGG - Intergenic
1174381285 20:50156905-50156927 GTGCAGCAGTGGCACAATCTTGG + Intergenic
1174445897 20:50590863-50590885 GGGGTGCAGTAGCACAATCTCGG + Intronic
1174518468 20:51111736-51111758 GTGCAGCAGTGGCACAATCTTGG + Intergenic
1175880747 20:62257299-62257321 GTACAGGAGCAGCACAGCCTCGG - Intronic
1178275062 21:31229701-31229723 GTGCAGTAGCAGTGCAATCTCGG + Intronic
1178286330 21:31328419-31328441 GGAAAGCAGCAGCACAATCACGG + Intronic
1178407116 21:32334145-32334167 GAACAGCAGCAGCCCAACCTCGG + Exonic
1181308652 22:21931561-21931583 GGGCTGCAGTGGCACAATCTCGG + Intronic
1181439239 22:22927278-22927300 GGGCAGCAGCAGAACAAAGTGGG - Intergenic
1181572026 22:23772920-23772942 GAGCAGCAGCAGCAGCATCGGGG - Exonic
1181803147 22:25360129-25360151 GTCCAGCTGCAGCACGATGTCGG + Exonic
1181891274 22:26065618-26065640 GTGCAGTGGCGGCGCAATCTCGG - Intergenic
1182230903 22:28836866-28836888 GTGGTGCAGTGGCACAATCTTGG - Intergenic
1182243693 22:28937651-28937673 CTGCAGTAGCAGCAGCATCTGGG - Intronic
1182911658 22:33989535-33989557 GTGGTGCAGCGGCACTATCTTGG + Intergenic
1183283704 22:36949090-36949112 GAGCAGAAGCATCACCATCTTGG - Intergenic
1183416258 22:37684038-37684060 GGGGTGCAGCAGCGCAATCTCGG + Intronic
1183920365 22:41162117-41162139 GAGCAGCACCAGAACAATCTGGG - Intronic
949311546 3:2704244-2704266 GGAGAGCAGCGGCACAATCTAGG - Intronic
949822458 3:8130763-8130785 GGGCTGCAGTGGCACAATCTGGG - Intergenic
949918798 3:8985596-8985618 GTCCAGCAGCAGCAGCAGCTCGG - Exonic
950796455 3:15514310-15514332 GACCAGCAGCATCACACTCTTGG + Intronic
950822362 3:15774925-15774947 GGAGTGCAGCAGCACAATCTCGG + Intronic
951110817 3:18801869-18801891 GTGCAGCAGCAGCAGAGACAGGG + Intergenic
951160018 3:19407818-19407840 GGGCAGCTGAAGCTCAATCTAGG - Intronic
952591512 3:34960741-34960763 GAGCAGCAGAAGCATGATCTGGG - Intergenic
952972684 3:38662633-38662655 GTTCAGCAGCAACACACTGTAGG + Intergenic
953257918 3:41307197-41307219 GTGCAGCAGCAGAAAAATACTGG + Intronic
953899048 3:46828672-46828694 GGCATGCAGCAGCACAATCTCGG + Intergenic
954315280 3:49797956-49797978 CTGGAGCAGTGGCACAATCTTGG + Intronic
955154320 3:56401792-56401814 GTACAGCAGCAGCAGAAGCAGGG + Intronic
955679496 3:61485740-61485762 GTGCTGCAGTGGCACAATCTTGG - Intergenic
958006462 3:87818461-87818483 CTCCAGCAGCAGAAAAATCTGGG + Intergenic
959158725 3:102697735-102697757 GTAGTGCAGTAGCACAATCTCGG - Intergenic
960826297 3:121788608-121788630 GTGAAGAAGCTGCATAATCTGGG - Intronic
960863586 3:122178481-122178503 GTGCAGCAATGGCACGATCTCGG + Intergenic
960996156 3:123341973-123341995 GAGTAGCAGCAGCAAGATCTTGG + Intronic
961188692 3:124938907-124938929 GTGGTGCAGCAGTGCAATCTCGG - Intronic
961247994 3:125473464-125473486 GGAGTGCAGCAGCACAATCTCGG + Intronic
961566667 3:127768909-127768931 GAGCAGCAGCAGCACCACCCAGG - Intronic
961751023 3:129094987-129095009 GATCAGCAGCTGCACAATGTTGG + Exonic
962572638 3:136726472-136726494 GGAGTGCAGCAGCACAATCTCGG + Intronic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
963175022 3:142289203-142289225 GTGAAGCAGCATCACTGTCTAGG - Intergenic
963225425 3:142857212-142857234 GAGCAGCAGCAGCAAATGCTTGG + Intronic
963286969 3:143442669-143442691 GTGCGGTAGCACAACAATCTTGG - Intronic
963859955 3:150298771-150298793 GTGCAGCAGTGGCATGATCTTGG - Intergenic
964135753 3:153343279-153343301 CTGCATCAGCAGCACAACTTTGG - Intergenic
964713236 3:159694466-159694488 GAAGAGCAGTAGCACAATCTCGG - Intronic
964752332 3:160064055-160064077 GGAGTGCAGCAGCACAATCTTGG + Intergenic
965019755 3:163213640-163213662 GGAGTGCAGCAGCACAATCTTGG - Intergenic
965498864 3:169432851-169432873 TTGCAGCTGGAGCAGAATCTTGG - Intronic
966522191 3:180885858-180885880 GGACTGCAGTAGCACAATCTTGG + Intronic
968019014 3:195367263-195367285 CAGCAGCATCAGCACCATCTGGG - Intronic
968039798 3:195579444-195579466 CAGCAGCAGCATCACCATCTTGG + Exonic
968397502 4:256531-256553 GTCCAGCTGCTGCACCATCTGGG - Intergenic
968416968 4:446742-446764 GGAGTGCAGCAGCACAATCTTGG + Intronic
968746188 4:2361855-2361877 GGGCAGCAGCATCACAGTCTTGG + Intronic
969177451 4:5409597-5409619 ATGCAGCATCAGCTCAAACTGGG + Intronic
969761002 4:9181899-9181921 GCGCTGCAGTGGCACAATCTCGG + Intergenic
970077359 4:12239099-12239121 TTACAGCAGCATCACAATTTTGG + Intergenic
971367715 4:25990969-25990991 GTGAAGCAAAAGCACCATCTTGG - Intergenic
972448228 4:39167799-39167821 CAGCAGCAGCAGCACAATCTTGG - Intergenic
972897434 4:43640753-43640775 TTGCAGGAGCAGCAGATTCTTGG + Intergenic
973084125 4:46032835-46032857 GTGGTGCAGCGGCACGATCTAGG + Intergenic
973243509 4:47984565-47984587 GTACTGCAGTAGCACTATCTTGG - Intronic
974968298 4:68792436-68792458 GCGCAGCAGCAGCATCACCTTGG - Intergenic
975003430 4:69255752-69255774 GTGCAGCAGCAGCACCATCTTGG - Intergenic
975011720 4:69363117-69363139 GTGCAGCAGCAACACCATCTCGG - Intronic
975023481 4:69520439-69520461 GGGCAGCTGCAGCAGCATCTGGG - Intronic
976643399 4:87362473-87362495 GGAGTGCAGCAGCACAATCTCGG - Intronic
976717595 4:88139088-88139110 GGAGTGCAGCAGCACAATCTCGG - Intronic
976842475 4:89447346-89447368 CTGCACCAGCAGCAGAATCTTGG + Intergenic
977013599 4:91663848-91663870 GTGTTGCAGCATCACAATATTGG - Intergenic
978500223 4:109401242-109401264 ATGCAGCAGCAACAAAATTTTGG + Intergenic
978579984 4:110221861-110221883 GGAGTGCAGCAGCACAATCTTGG + Intergenic
979380796 4:120004189-120004211 GTTCAGCAGCACCACATTATAGG + Intergenic
979448705 4:120843281-120843303 GTGATGCAGTGGCACAATCTCGG - Intronic
979524582 4:121703714-121703736 GTGCAGTGGTGGCACAATCTCGG - Intergenic
980127713 4:128789316-128789338 GTGCTGCAGTAGCTCAATCTCGG - Intergenic
982684161 4:158467754-158467776 GGACTGCAGCAGCACTATCTCGG - Intronic
982793156 4:159615752-159615774 GAGCAGGAGCATCACCATCTTGG - Intergenic
982793669 4:159620968-159620990 GGAGTGCAGCAGCACAATCTTGG + Intergenic
983996760 4:174191428-174191450 GTGTCACAGCATCACAATCTGGG + Intergenic
984395043 4:179186830-179186852 GGAATGCAGCAGCACAATCTCGG - Intergenic
984604100 4:181764739-181764761 GTACTGCAGCAGTACAGTCTCGG + Intergenic
985093823 4:186392093-186392115 CAGCAGCAGCAGCAGCATCTTGG + Intergenic
985620687 5:953381-953403 GTGCAGCAGAAACACCATCTGGG + Intergenic
986686574 5:10279987-10280009 GTACAGTAGTGGCACAATCTTGG + Exonic
987002545 5:13674848-13674870 GTGCAGTGGCAGCATAATCATGG + Intergenic
987379522 5:17272013-17272035 GTGCAGCAGCAGCACAATCTCGG - Intronic
987788823 5:22537394-22537416 GAGCAGCAGCATCACTATCTTGG + Intronic
987934585 5:24447828-24447850 GGGCAGCAGCAGGACAATTTGGG + Intergenic
988503873 5:31805142-31805164 GTGCAATGGCGGCACAATCTAGG - Intronic
988572424 5:32382258-32382280 GGAGTGCAGCAGCACAATCTCGG - Intronic
988847577 5:35144502-35144524 ATACAGCAGTGGCACAATCTCGG + Intronic
989390339 5:40894066-40894088 ATTCAGCAGCAGCACACTATAGG - Intergenic
991011596 5:61888409-61888431 GTTCAGCAGCACCACACTTTAGG + Intergenic
991232120 5:64346418-64346440 GTAGTGCAGTAGCACAATCTCGG + Intronic
991368631 5:65895141-65895163 GGAGTGCAGCAGCACAATCTTGG - Intergenic
991529221 5:67596730-67596752 GGAGTGCAGCAGCACAATCTCGG - Intergenic
993329526 5:86580422-86580444 GGGATGTAGCAGCACAATCTTGG - Intergenic
993607242 5:90006663-90006685 GTGGTGCAGTGGCACAATCTAGG - Intergenic
993723698 5:91345822-91345844 GTGGTGCAGTGGCACAATCTCGG + Intergenic
993764702 5:91841702-91841724 GTGCAGCATCAGCACCACCTGGG - Intergenic
993913943 5:93718386-93718408 CTGGAGCAGTGGCACAATCTCGG - Intronic
994597170 5:101854205-101854227 GTTCAGCATCAGCACACTGTAGG + Intergenic
994624494 5:102201197-102201219 GAGCAGGAGCATCACCATCTTGG - Intergenic
994791333 5:104230171-104230193 GGGCAGCAGCAGCAGTGTCTTGG - Intergenic
995133498 5:108655935-108655957 GTGCAGCAGAAAAAAAATCTAGG - Intergenic
995166128 5:109043918-109043940 GGAGTGCAGCAGCACAATCTCGG - Intronic
995525312 5:113046233-113046255 GTGCAGCCGCACCACAGCCTGGG - Intronic
996998136 5:129724538-129724560 GTGAAGCAGCATCATTATCTGGG + Intronic
997881626 5:137597153-137597175 GTTCAGCAGCTGCTCACTCTTGG + Intronic
997926009 5:138032255-138032277 GTGCACCAACAGCCCAATTTTGG + Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
1000750316 5:165087318-165087340 GTGCAGCAGTGGCGCAATCTTGG + Intergenic
1001160693 5:169310121-169310143 GTAGTGCAGTAGCACAATCTCGG - Intergenic
1001341456 5:170850092-170850114 GAACTGCAGCAGCACAATCACGG - Intergenic
1002845347 6:940098-940120 GAGCATCAGCAGCACAGTCTCGG - Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1005074633 6:21895029-21895051 GCAGTGCAGCAGCACAATCTCGG - Intergenic
1005324252 6:24683483-24683505 GGAGCGCAGCAGCACAATCTCGG - Intronic
1005357417 6:24997832-24997854 GAGCAGCATCAGCATCATCTGGG + Intronic
1005370135 6:25123710-25123732 ACGGAGCAGCAGCACTATCTGGG + Intergenic
1005787665 6:29263000-29263022 GAGCAGGAGCATCACCATCTTGG + Intergenic
1006506015 6:34489128-34489150 GTGCAGCAGTGGCACCAACTCGG - Intronic
1006623050 6:35380537-35380559 GTAGTGCAGTAGCACAATCTCGG + Intronic
1007228594 6:40332033-40332055 GGGCAGTAGCAGCCCTATCTAGG - Intergenic
1007731698 6:43951430-43951452 GAGGAGCAGCAGCACACCCTGGG + Intergenic
1008326953 6:50193525-50193547 GTGGTGCAGTGGCACAATCTTGG - Intergenic
1011119741 6:83938883-83938905 GTGCAGTGGCATCGCAATCTCGG + Intronic
1011275295 6:85625436-85625458 GTGCAGCAGTGGCACTATCTCGG + Intronic
1011469693 6:87696125-87696147 GGAGTGCAGCAGCACAATCTCGG - Intronic
1011826121 6:91307624-91307646 GAGGTGCAGCGGCACAATCTTGG - Intergenic
1012457401 6:99422821-99422843 GTGCAGTGGTGGCACAATCTTGG - Intronic
1012651262 6:101756112-101756134 GTGCAGCAGCAGCACTAACAAGG - Intronic
1012901971 6:105017020-105017042 GGAGTGCAGCAGCACAATCTTGG - Intronic
1014237848 6:118979995-118980017 GAGGTGCAGCAGCACAATCATGG - Intronic
1014251511 6:119119931-119119953 GTGCTGCAGCGGCACAATCATGG - Intronic
1014436841 6:121430038-121430060 GGAGGGCAGCAGCACAATCTTGG + Intergenic
1014558568 6:122863240-122863262 GGAGTGCAGCAGCACAATCTCGG + Intergenic
1014621294 6:123669847-123669869 GGAGTGCAGCAGCACAATCTTGG - Intergenic
1015769488 6:136754220-136754242 GGGGAGCAGTGGCACAATCTTGG - Intronic
1015970172 6:138735535-138735557 GTGCAGCAGTGGCACAATCTTGG - Intergenic
1016615356 6:146041622-146041644 GTTCAGCAGCACCACATTGTAGG - Intronic
1017200396 6:151747261-151747283 GTGCAGCACAAATACAATCTAGG + Intronic
1017609793 6:156173403-156173425 CAGCAGCATCAGCACCATCTGGG + Intergenic
1017934132 6:158989534-158989556 GTTCAGCAGCACCACATTGTAGG - Intronic
1018180946 6:161223002-161223024 GTGAAGCAGCATCACAAGCCAGG - Intronic
1018974120 6:168551502-168551524 GGCGAGCAGCAGCACAATCTTGG + Intronic
1020017483 7:4839795-4839817 GAGTAGCAGTAGCAAAATCTTGG + Intronic
1021112069 7:16706868-16706890 GGGGTGCAGTAGCACAATCTTGG - Intergenic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1021903399 7:25310092-25310114 CAGCAGCATCAGCACCATCTGGG + Intergenic
1022146158 7:27543078-27543100 GTGTAGGAGCTGCACGATCTGGG - Exonic
1022650753 7:32272017-32272039 TTGCAGCAGCAGCTCAGCCTTGG + Intronic
1024003084 7:45203802-45203824 GGGCAGCAGCAGCCCACTCATGG + Intergenic
1024301555 7:47890934-47890956 GTGCAGCAGCACCACCACCTGGG + Intronic
1024626755 7:51214213-51214235 GTGCAGTGGCGGCACAATCTCGG - Intronic
1025222309 7:57123780-57123802 GTAGTGCAGTAGCACAATCTTGG - Intronic
1025266622 7:57465401-57465423 GTAGTGCAGTAGCACAATCTTGG + Intronic
1025633090 7:63295461-63295483 GTAGTGCAGTAGCACAATCTTGG - Intergenic
1025649606 7:63452722-63452744 GTAGTGCAGTAGCACAATCTTGG + Intergenic
1025743058 7:64216654-64216676 GTAGTGCAGTAGCACAATCTTGG + Intronic
1025974812 7:66361407-66361429 GGCCTGCAGTAGCACAATCTCGG + Intronic
1026146981 7:67754976-67754998 GAGCAGGAGCATCACCATCTTGG - Intergenic
1026341676 7:69439582-69439604 GAAGTGCAGCAGCACAATCTGGG - Intergenic
1026411000 7:70122924-70122946 GGAGTGCAGCAGCACAATCTTGG + Intronic
1026883481 7:73921985-73922007 GTACAGCAGCAGCAGCAGCTGGG - Intergenic
1026959688 7:74400431-74400453 GTGCTGCAGCCGCAGAAGCTCGG - Exonic
1027621674 7:80494631-80494653 TTGCAGGAGCAGGAGAATCTGGG - Exonic
1028962545 7:96765491-96765513 GAGCAGCAGCAGCAGCAGCTGGG - Intergenic
1029328005 7:99826254-99826276 GTGCAGCAGCAGGAAGATATGGG + Intergenic
1029960123 7:104681569-104681591 GGGCTGCAGTGGCACAATCTCGG - Intronic
1030009795 7:105154725-105154747 GAGCAGCAGTGACACAATCTCGG + Intronic
1030307933 7:108038208-108038230 GTGCAGTGGTGGCACAATCTCGG + Intronic
1031074262 7:117197999-117198021 GTGGTGCAGCAGCACAATCATGG - Intronic
1031187027 7:118494760-118494782 ATGGAGCACCTGCACAATCTTGG - Intergenic
1031610965 7:123826907-123826929 GTGCCTCAGGAGCAAAATCTTGG - Intergenic
1032258126 7:130313031-130313053 GAGCAGGAGCATCACCATCTTGG - Intronic
1032628742 7:133623656-133623678 GTCCAGCAGCAGCTCACCCTTGG + Intronic
1032759696 7:134928376-134928398 GGAGTGCAGCAGCACAATCTCGG - Intronic
1034051703 7:147990712-147990734 GAGCAGGAGCATCACCATCTTGG - Intronic
1034241083 7:149611392-149611414 GGAGTGCAGCAGCACAATCTTGG - Intergenic
1034502812 7:151461821-151461843 ATGAGGCAGCAGCACATTCTGGG + Intergenic
1035297474 7:157875663-157875685 CTGCAGCAGCAGCAGCACCTTGG + Intronic
1035319087 7:158016916-158016938 GTGCAGCAGCAGGGCACTGTAGG - Intronic
1035770289 8:2141824-2141846 GAGCAGCAGCACCGCCATCTTGG - Intronic
1037578696 8:20231714-20231736 GCCCAGCAGCAGCACCATCATGG + Intergenic
1037796686 8:22001253-22001275 GTGCAGAAGTGGCACGATCTCGG - Intronic
1037860856 8:22404709-22404731 GTGCAGCAGCAGCAGCTTCATGG - Exonic
1038578450 8:28726004-28726026 GTGGTGCAGTGGCACAATCTCGG + Intronic
1038709937 8:29933987-29934009 CTGAAGCAGGAGCAAAATCTGGG - Intergenic
1038815716 8:30902009-30902031 CAGCAGCATCAGCACAACCTGGG + Intergenic
1039381742 8:37092124-37092146 GGGCAGTGGCAGCACAATCTCGG + Intergenic
1039496812 8:37986559-37986581 GTGGTGCAGTCGCACAATCTTGG + Intergenic
1039659502 8:39447405-39447427 GAGCAGGAGCATCACGATCTTGG + Intergenic
1041251335 8:55937744-55937766 GTGCAGTGGCACAACAATCTTGG + Intronic
1041412949 8:57576773-57576795 GTGCAACAAGAGCTCAATCTCGG + Intergenic
1041684092 8:60626443-60626465 GTGCAGTAGTGGCACAATCTTGG - Intergenic
1041804287 8:61833132-61833154 GTAGTGCAGTAGCACAATCTTGG + Intergenic
1041910477 8:63083933-63083955 GTGGTGCAGTAGCACAATCTCGG + Intronic
1042730184 8:71924921-71924943 CTGCAGCATCAGCAAAATATAGG + Intronic
1042783442 8:72519331-72519353 GGAGTGCAGCAGCACAATCTCGG - Intergenic
1042866506 8:73361294-73361316 GTGCAGTGGCAGTGCAATCTCGG - Intergenic
1042933001 8:74031579-74031601 GTGCAGTAGTGGCACGATCTCGG - Intergenic
1043549691 8:81356500-81356522 GGAGTGCAGCAGCACAATCTTGG - Intergenic
1043932672 8:86108537-86108559 GTTCAGCAGCAGCAGAGTGTGGG + Intronic
1045034344 8:98165737-98165759 CTGCAGCAGTGGCACAATCTTGG + Intergenic
1045997687 8:108382549-108382571 GTGCAGCAGTGGCACGATCCTGG - Intronic
1046231302 8:111361986-111362008 GTGCTGCAGTAGCACAATCTCGG + Intergenic
1047490595 8:125371193-125371215 GTGCAGTAGTAGCACGATCTTGG - Intergenic
1047764388 8:127978532-127978554 GTGCAGAGGCGGCACAATTTCGG + Intergenic
1047836914 8:128703804-128703826 CTGCAGCAGCAGCAGCAACTTGG - Intergenic
1047860267 8:128958191-128958213 TGGAAGCAGCAGCACATTCTTGG + Intergenic
1048262698 8:132958665-132958687 CTGGTGCAGCAGCACGATCTCGG - Intronic
1048437474 8:134431826-134431848 GGGCAGCAGCAATGCAATCTAGG + Intergenic
1049666631 8:143846910-143846932 ATGCAGCAGCAGCACAAGTTTGG + Intergenic
1049909250 9:249666-249688 GTGGTGCAGTGGCACAATCTTGG + Intronic
1049927520 9:423920-423942 TTGCAGGAGCAACACAATATTGG + Intronic
1050186608 9:2981600-2981622 CTGCAGCAGCCACACATTCTAGG - Intergenic
1050417103 9:5429327-5429349 GTGCAGCAGCACCACCTGCTTGG + Intronic
1050532986 9:6607010-6607032 GTGCAGCAGCGGTGCAATCTTGG - Intronic
1050952413 9:11614664-11614686 GTCCAGCAGCATAACAAACTTGG - Intergenic
1050986719 9:12091948-12091970 GTGCAGCAGCAGCAGCATGCTGG + Intergenic
1052306877 9:27020523-27020545 GGGGTGCAGCAGCCCAATCTCGG + Intronic
1052545004 9:29864909-29864931 GGACTGCAGTAGCACAATCTCGG - Intergenic
1052737978 9:32364115-32364137 GGAGAGCAGCAGCACGATCTTGG - Intergenic
1053506442 9:38647610-38647632 GTGCAGTAGTGGCACGATCTAGG + Intergenic
1053530397 9:38875581-38875603 GGGCAGCAGCAGCAGCTTCTTGG - Intergenic
1054202623 9:62100011-62100033 GGGCAGCAGCAGCAGCTTCTTGG - Intergenic
1054635739 9:67488354-67488376 GGGCAGCAGCAGCAGCTTCTTGG + Intergenic
1054820632 9:69517065-69517087 CCGCAGCAGCAGCACTATGTGGG - Exonic
1054904531 9:70403097-70403119 GGAGTGCAGCAGCACAATCTCGG - Intronic
1055165302 9:73184821-73184843 GGGCTGCAGCAGCACAATGCTGG + Intergenic
1055231650 9:74074048-74074070 GTGCAGCTGCAGCCCTGTCTGGG - Intergenic
1055829387 9:80360464-80360486 CTGCAGCAGCAGGACAACCCCGG - Intergenic
1056017437 9:82405211-82405233 AGGCAGCAGCAGCAGAATCTGGG + Intergenic
1056034029 9:82584904-82584926 GTGCAGCAACCCCACAATGTAGG + Intergenic
1056286992 9:85098517-85098539 GTGCCGTAGCAGCACAATCTCGG + Intergenic
1056819505 9:89828395-89828417 GGAGTGCAGCAGCACAATCTTGG - Intergenic
1057903661 9:98967977-98967999 GACCAGCAGCAGCAGTATCTGGG - Intronic
1058891567 9:109365784-109365806 GGGGTGCAGTAGCACAATCTCGG + Intergenic
1058913080 9:109539106-109539128 GTTCTGCAGCAGCAAGATCTTGG - Intergenic
1058957429 9:109962100-109962122 GGGCAGCACCTGCACAGTCTCGG - Intronic
1059243432 9:112828380-112828402 GTGTAGTAGCCGCACCATCTAGG + Intronic
1059418417 9:114176029-114176051 GGGCAGCTGCCACACAATCTTGG - Intronic
1059781320 9:117530975-117530997 GGAGAGCAGCGGCACAATCTTGG - Intergenic
1060079337 9:120627511-120627533 GTGGTGCAGTGGCACAATCTCGG + Intronic
1060158968 9:121342311-121342333 GTGCAGCAGTGGCATGATCTCGG - Intronic
1060256852 9:122038596-122038618 GGAGAGCAGCAGCACGATCTTGG - Intronic
1060556302 9:124508918-124508940 GGACTGCAGTAGCACAATCTTGG - Intergenic
1060608251 9:124937400-124937422 GGAGTGCAGCAGCACAATCTCGG - Intronic
1060621797 9:125074305-125074327 GGAGTGCAGCAGCACAATCTTGG + Intronic
1060642534 9:125251023-125251045 GTAGTGCAGTAGCACAATCTTGG + Intergenic
1061164759 9:128915961-128915983 CCCCAGCATCAGCACAATCTGGG - Intronic
1061428558 9:130516631-130516653 GGAGTGCAGCAGCACAATCTCGG - Intergenic
1061570912 9:131476961-131476983 GTGGAGAAGCAGAACCATCTAGG - Intronic
1061973195 9:134055648-134055670 AGGCAGCAGCAGCACAGCCTGGG - Intronic
1185619492 X:1444741-1444763 GGGCAGCAGCAGCTCATCCTGGG + Intronic
1185706194 X:2267894-2267916 GGGGTGCAGTAGCACAATCTCGG - Intronic
1186880084 X:13856382-13856404 CAGCAGCAGCAGCAGCATCTGGG + Intronic
1187830800 X:23379382-23379404 CAGCAGCAGCAGCATAACCTGGG - Intronic
1187862160 X:23693142-23693164 GGAGTGCAGCAGCACAATCTCGG + Intergenic
1188005393 X:25013101-25013123 GTGCAGCAGCAGCTCCTCCTTGG + Exonic
1188184731 X:27100098-27100120 GTGCAGTGGCCCCACAATCTTGG + Intergenic
1188878799 X:35466715-35466737 CTGGAGTAGCAGCACGATCTCGG - Intergenic
1189140192 X:38596613-38596635 GTGCAACATCAGCATCATCTGGG + Intronic
1189451020 X:41130774-41130796 GTAGTGCAGTAGCACAATCTTGG + Intronic
1189614639 X:42770548-42770570 GAGCAGGAGCATCACCATCTTGG + Intergenic
1190009947 X:46775882-46775904 GTGCAGCAGTGGCACCATCTTGG + Intergenic
1190049185 X:47136728-47136750 GTGCAGTGGTGGCACAATCTCGG - Intergenic
1190443200 X:50496208-50496230 AAGCAGCAGCAGCATCATCTGGG + Intergenic
1190962437 X:55266071-55266093 GTGCATCAGCAATACAAACTTGG + Intronic
1192079336 X:68032399-68032421 GGGCTGCAGCAGCACAATTAAGG + Intergenic
1192458318 X:71296194-71296216 GTGGTGCAGTGGCACAATCTCGG + Intronic
1193497570 X:82233154-82233176 GGGCAACAGCAGCACAATGCTGG - Intergenic
1194103883 X:89743187-89743209 GTGCAGTAGTGGCGCAATCTCGG - Intergenic
1194117469 X:89920838-89920860 GTGCAGTAGTGGCGCAATCTCGG - Intergenic
1194135748 X:90138611-90138633 GAGCAGGAGCATCACCATCTTGG - Intergenic
1194590342 X:95792549-95792571 GGAGTGCAGCAGCACAATCTCGG - Intergenic
1194666623 X:96683968-96683990 GTGCAGCAGCAGGGCACTGTTGG - Intergenic
1194877764 X:99210122-99210144 GTCCTGAAGCAGCACAATTTTGG + Intergenic
1195095348 X:101496306-101496328 GTGCAGCAGGAGTCCAAGCTGGG + Intronic
1195239609 X:102937830-102937852 GTGCCGCAGCAGCACTATCCTGG - Exonic
1195298099 X:103500223-103500245 GTGCCGCAGCAGCACTATCCTGG + Exonic
1196010421 X:110881021-110881043 GTGCAACAGCAGCACCACCAAGG - Intergenic
1197190513 X:123642372-123642394 GTGCTGCAGTGGCACGATCTTGG - Intronic
1198311971 X:135433211-135433233 CTGCAGCTGCTGCACAAGCTGGG - Intergenic
1198415804 X:136418600-136418622 CAGCAGCAGCAGAACAATCAAGG - Intergenic
1198426052 X:136521277-136521299 CTGCAGCAGCAGCACCACCTGGG - Intergenic
1199137201 X:144267011-144267033 GTGCAGTGGCAGCACAATCATGG + Intergenic
1199256932 X:145727988-145728010 GGGCAACAGCAGCAGAAACTGGG + Intergenic
1199818899 X:151424820-151424842 GGGCAACAGCAGCAAAATCAGGG + Intergenic
1200075580 X:153549078-153549100 GTTCAGCATCTGCACAATGTGGG + Intronic
1200455836 Y:3390939-3390961 GTGCAGTAGTGGCGCAATCTCGG - Intergenic
1200470258 Y:3577981-3578003 GTGCAGTAGTGGCGCAATCTCGG - Intergenic
1200481510 Y:3708678-3708700 GAGCAGGAGCATCACCATCTTGG - Intergenic
1201129533 Y:10942199-10942221 GAAGAGCAGCGGCACAATCTTGG + Intergenic
1201423460 Y:13824447-13824469 GTAGTGCAGTAGCACAATCTTGG - Intergenic