ID: 987379895

View in Genome Browser
Species Human (GRCh38)
Location 5:17275513-17275535
Sequence GCCCCCGAAGGCGCCCGAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987379890_987379895 14 Left 987379890 5:17275476-17275498 CCGAGAAGACGGAGGGCGCGGCA 0: 1
1: 0
2: 0
3: 7
4: 120
Right 987379895 5:17275513-17275535 GCCCCCGAAGGCGCCCGAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 108
987379883_987379895 28 Left 987379883 5:17275462-17275484 CCCGAAGGCGGAGCCCGAGAAGA 0: 1
1: 0
2: 1
3: 7
4: 110
Right 987379895 5:17275513-17275535 GCCCCCGAAGGCGCCCGAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 108
987379889_987379895 15 Left 987379889 5:17275475-17275497 CCCGAGAAGACGGAGGGCGCGGC 0: 1
1: 0
2: 2
3: 7
4: 101
Right 987379895 5:17275513-17275535 GCCCCCGAAGGCGCCCGAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 108
987379884_987379895 27 Left 987379884 5:17275463-17275485 CCGAAGGCGGAGCCCGAGAAGAC 0: 1
1: 0
2: 2
3: 4
4: 73
Right 987379895 5:17275513-17275535 GCCCCCGAAGGCGCCCGAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 108
987379882_987379895 29 Left 987379882 5:17275461-17275483 CCCCGAAGGCGGAGCCCGAGAAG 0: 1
1: 0
2: 1
3: 9
4: 86
Right 987379895 5:17275513-17275535 GCCCCCGAAGGCGCCCGAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987379895 Original CRISPR GCCCCCGAAGGCGCCCGAGC AGG Exonic