ID: 987379895

View in Genome Browser
Species Human (GRCh38)
Location 5:17275513-17275535
Sequence GCCCCCGAAGGCGCCCGAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987379889_987379895 15 Left 987379889 5:17275475-17275497 CCCGAGAAGACGGAGGGCGCGGC 0: 1
1: 0
2: 2
3: 7
4: 101
Right 987379895 5:17275513-17275535 GCCCCCGAAGGCGCCCGAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 108
987379884_987379895 27 Left 987379884 5:17275463-17275485 CCGAAGGCGGAGCCCGAGAAGAC 0: 1
1: 0
2: 2
3: 4
4: 73
Right 987379895 5:17275513-17275535 GCCCCCGAAGGCGCCCGAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 108
987379882_987379895 29 Left 987379882 5:17275461-17275483 CCCCGAAGGCGGAGCCCGAGAAG 0: 1
1: 0
2: 1
3: 9
4: 86
Right 987379895 5:17275513-17275535 GCCCCCGAAGGCGCCCGAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 108
987379883_987379895 28 Left 987379883 5:17275462-17275484 CCCGAAGGCGGAGCCCGAGAAGA 0: 1
1: 0
2: 1
3: 7
4: 110
Right 987379895 5:17275513-17275535 GCCCCCGAAGGCGCCCGAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 108
987379890_987379895 14 Left 987379890 5:17275476-17275498 CCGAGAAGACGGAGGGCGCGGCA 0: 1
1: 0
2: 0
3: 7
4: 120
Right 987379895 5:17275513-17275535 GCCCCCGAAGGCGCCCGAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987379895 Original CRISPR GCCCCCGAAGGCGCCCGAGC AGG Exonic
900800219 1:4732524-4732546 GCCCCCGAAGGAGCCCAAGTTGG - Intronic
901068703 1:6506743-6506765 GCCCCCAGAGGCCCCCCAGCAGG + Intronic
903324683 1:22563302-22563324 GCCCCCGAAGGTGCCCGCCGGGG + Intergenic
905028323 1:34865890-34865912 CCACGCGAAGGCGCCCGGGCTGG - Exonic
906103766 1:43279526-43279548 GCCCCACAGGGTGCCCGAGCTGG - Intergenic
914444745 1:147740437-147740459 GCCCCTGTAGGCGCCTGACCGGG - Intergenic
915555119 1:156656956-156656978 GCCCTGGAAGGCGTCCCAGCCGG - Exonic
917565251 1:176206790-176206812 GCCCCCGAGGCCGCCCGAGCCGG + Exonic
919764063 1:201115148-201115170 GACCCCGAAGGCGCCGGGGAAGG + Exonic
921050289 1:211506231-211506253 GTCCCCAAAGGCACCTGAGCTGG + Intergenic
1069651617 10:70053474-70053496 GCCTCTGAAGGTGCCCGGGCAGG + Intronic
1070756759 10:78998103-78998125 GCCCCCGAGGGTGCACGAGGGGG + Intergenic
1070800876 10:79243693-79243715 GCCCCCGAGGGCGCCAGGGCGGG + Intronic
1077060924 11:617586-617608 CCCCCCGCAGCGGCCCGAGCTGG - Exonic
1077142368 11:1030226-1030248 GCACCCGAAGGTGCAGGAGCTGG + Exonic
1082066575 11:47905660-47905682 GCCCCCGAAGGACCCGCAGCTGG + Intergenic
1083432570 11:62621954-62621976 GCCGCCGCCCGCGCCCGAGCAGG + Exonic
1084814705 11:71639402-71639424 GCCCGCGGAGGAGCCCGCGCCGG + Intergenic
1089966102 11:122656008-122656030 GCCAGGGAAGGAGCCCGAGCCGG - Exonic
1098355637 12:69610334-69610356 GCTCCTGGAGGCGCCGGAGCTGG + Exonic
1106242890 13:27924603-27924625 GCCCCCGTTGCCGCCCGAGAGGG + Exonic
1116941843 14:50798416-50798438 CCCCCCGAAGGTGCCTAAGCTGG + Intronic
1119485095 14:74981730-74981752 GCTCCCGCAGGCTCCCAAGCTGG - Intergenic
1122635680 14:103128595-103128617 GCCACCCAAGGCCCCCGAGACGG - Intronic
1122779903 14:104139148-104139170 GCTCCCGAAGGCGCCGGGGCCGG + Exonic
1123441489 15:20295140-20295162 GCCGCCGCCGGCGCCCGAGCCGG + Intergenic
1124500370 15:30223083-30223105 GCCCCCGGAGGCGGCGGAGGAGG + Intergenic
1124743203 15:32315583-32315605 GCCCCCGGAGGCGGCGGAGGAGG - Intergenic
1132580874 16:684143-684165 GTGCCCGCAGGCGCCCGGGCGGG - Exonic
1133369938 16:5239739-5239761 GCCCGCGGAGGAGCCCGCGCCGG + Intergenic
1134107548 16:11494716-11494738 GCCCAGGAAGGCGCCAGGGCTGG + Exonic
1136479935 16:30534770-30534792 GCCCCCGAAGGCCCACTAGAGGG + Exonic
1136483806 16:30558306-30558328 GCCCCCGAGGGCGCACTAGAGGG + Intronic
1141132183 16:81444463-81444485 GCCCCCGCGGGTGCCCGGGCGGG - Intergenic
1142120228 16:88383359-88383381 GCCCCCGAGGGCGCAGGAGCGGG - Intergenic
1142178632 16:88656602-88656624 GCCCCCGAGGACACCCAAGCTGG + Intronic
1142186507 16:88697377-88697399 GCCGCCGAGGCCGCCAGAGCAGG - Exonic
1142504829 17:356742-356764 GCCTCCGAAGGGGCAGGAGCAGG - Intronic
1147311633 17:39599215-39599237 GCCCCTGGAGGGGCCCGCGCCGG - Intergenic
1147564496 17:41528059-41528081 GCCGCCGTAGGCCCCCGAGGAGG + Exonic
1148835913 17:50465705-50465727 ACCGCCGAAGGCCCCGGAGCTGG + Exonic
1149891341 17:60392421-60392443 GCCAGCGGAGGCGCCCGGGCGGG - Intronic
1150414438 17:64975706-64975728 GCCCCTGAGCGCGCCAGAGCTGG + Intergenic
1151293316 17:73165683-73165705 GCTCCCGCAGGAGCCCCAGCTGG - Intronic
1151960301 17:77402270-77402292 GGGCCCCAAGGCGGCCGAGCCGG + Exonic
1152568576 17:81111337-81111359 ACACCCGAAGGAGCCCAAGCTGG - Intronic
1155096368 18:22559808-22559830 GCCCCCGCGGGCGTCCGGGCCGG - Intergenic
1157384205 18:47248005-47248027 GCCCCCGAACGAGCCCTTGCTGG + Intronic
1157867117 18:51197002-51197024 GGCCCCGGAGGCGGCCGAGCTGG - Exonic
1160454803 18:78992833-78992855 GCCCTCGAAGGCGGCCGGGGCGG - Exonic
1160562847 18:79770494-79770516 GCCCACGGAGGCTCCCGTGCAGG - Intergenic
1160865432 19:1253953-1253975 GCCCCCAGCGGCGCCCGGGCCGG + Intronic
1164986097 19:32649858-32649880 GTCCCCAAAGGCGCTCCAGCTGG + Intronic
1164990042 19:32676392-32676414 GCGCCAGAAGGCGCAGGAGCTGG + Exonic
1165311225 19:35030492-35030514 GCGCCCGAGCGCGCCCGAGCCGG + Intergenic
1165751750 19:38264532-38264554 GCTCCCGAAGGTGGCCGGGCAGG - Exonic
1166072745 19:40396410-40396432 ACTCCCGAAGGTGCCCGAGATGG - Exonic
1166072765 19:40396518-40396540 ACTCCCGAAGGTGCCCGAGATGG - Exonic
1166361053 19:42253250-42253272 GCCCTCTATGGCGCCAGAGCCGG + Intronic
1166762562 19:45234309-45234331 GACGCCGAAGGCGCCCAGGCCGG + Intronic
1167075209 19:47244260-47244282 GCTTCCGGAGGCGCCCGGGCGGG + Intergenic
1168272730 19:55258768-55258790 GCCCACGCAGGCGCCTCAGCCGG + Exonic
925744822 2:7034845-7034867 ACTCCCGAAGGCTCCCCAGCCGG - Intronic
926198540 2:10777771-10777793 TTCCCAGAAGGCGCCTGAGCTGG - Intronic
927905176 2:26849874-26849896 GCACCAGAAGGCACCCGAGCCGG - Intronic
930029640 2:47050173-47050195 GCCCCAGAAGTTGCCCGAGCTGG - Intronic
937259567 2:120576820-120576842 GCCACCGAGGGGGCACGAGCTGG + Intergenic
946386583 2:219387694-219387716 GCCCCGGAGGGCGCCGGACCCGG + Intronic
948560670 2:238849149-238849171 GCCCGCGAAGCTGCCCGAGCCGG + Intronic
1169278485 20:4248868-4248890 GCCCCCGCCGCCGCCCGCGCTGG + Exonic
1171123226 20:22582957-22582979 GCCCGCCATGGCGCCCGCGCCGG + Exonic
1172118586 20:32585080-32585102 GCCGCCGCCGCCGCCCGAGCAGG - Intronic
1172587051 20:36092479-36092501 GCCGCCGGAGCCGCCGGAGCTGG - Intronic
1176364692 21:6025776-6025798 GCCCCCAGAGGGGCCCTAGCCGG + Intergenic
1179758826 21:43512769-43512791 GCCCCCAGAGGGGCCCTAGCCGG - Intergenic
1179939470 21:44628478-44628500 GCCCCCCGAGGCCCCCCAGCTGG - Intronic
1184766892 22:46576964-46576986 GCCCCCGCGGACCCCCGAGCCGG + Intronic
955228460 3:57079367-57079389 ACCCCCGCGGGCGCCGGAGCCGG + Intergenic
957072988 3:75580326-75580348 GCCCGCGGAGGAGCCCGCGCCGG - Intergenic
961402138 3:126654957-126654979 GCCGCCGCAGTCGCCCGGGCCGG - Intronic
961873289 3:130003133-130003155 GCCCGCGGAGGAGCCCGCGCCGG - Intergenic
963236635 3:142963263-142963285 GCCCCCGAAGCTGCCGGGGCCGG + Exonic
968498030 4:929203-929225 GACCCCCAAGGCTCCTGAGCGGG + Intronic
969016592 4:4107624-4107646 GCCCGCGGAGGAGCCCGCGCCGG - Intergenic
970332817 4:15002986-15003008 GCCCCCGAAAGCGGCCGCGCCGG - Exonic
974250524 4:59377886-59377908 GCACACTAAGGCGCCCAAGCTGG + Intergenic
982357890 4:154490058-154490080 GTCTCTGAAGGCGCCCGACCGGG - Intronic
983923468 4:173371344-173371366 GCCCCCGGGGGCGGCCGGGCCGG + Exonic
987379895 5:17275513-17275535 GCCCCCGAAGGCGCCCGAGCAGG + Exonic
992866292 5:80960433-80960455 CCCCGCGAGGGCGCCCGAGCCGG - Intergenic
992939491 5:81749973-81749995 GCCGCCGGGGGCGCCCGAGGAGG - Intronic
998374527 5:141682098-141682120 GCCCACGAAGGCCCTCGAGAAGG + Intronic
1001060736 5:168486600-168486622 GCCCCCGAAGCCGCTTGGGCAGG - Intronic
1002181848 5:177434811-177434833 GCCCCCGGAGGCGAGTGAGCTGG + Intronic
1002512651 5:179732982-179733004 GCCCCCGAGGGCAGCGGAGCGGG - Exonic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1009909256 6:69905101-69905123 GCCCCTGAAGGCTCCCGGGTTGG - Intronic
1013836719 6:114342882-114342904 GGCCCCCAGAGCGCCCGAGCCGG + Exonic
1017737810 6:157380588-157380610 GGCCCGGAAGCCGGCCGAGCCGG + Intergenic
1019738157 7:2660507-2660529 ACCCCTGAAGGAGCCCAAGCAGG - Intronic
1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG + Exonic
1022517736 7:30986762-30986784 GCCCCCAAAGGAGGCGGAGCAGG + Intronic
1023850555 7:44147727-44147749 GTCCCCGAAGGCGCCCCACTCGG + Exonic
1028987702 7:97021244-97021266 GCCCCAGAGGGCGCCCTGGCCGG + Intronic
1030143869 7:106332898-106332920 GCCCACCAAGGGGCCCGAGTTGG - Intergenic
1032119267 7:129144828-129144850 GCGGCGGGAGGCGCCCGAGCCGG - Intergenic
1036258330 8:7222056-7222078 GCCCGCGGAGGAGCCCGCGCCGG - Intergenic
1036307235 8:7611324-7611346 GCCCGCGGAGGAGCCCGGGCCGG + Intergenic
1036310384 8:7680652-7680674 GCCCGCGGAGGAGCCCGCGCCGG - Intergenic
1036358077 8:8059311-8059333 GCCCGCGGAGGAGCCCGGGCCGG + Intergenic
1036359153 8:8065451-8065473 GCCCGCGTAGGAGCCCGCGCCGG + Intergenic
1036891805 8:12601501-12601523 GCCCGCGTAGGAGCCCGCGCCGG - Intergenic
1036892870 8:12607635-12607657 GCCCGCGGAGGAGCCCGGGCCGG - Intergenic
1037803877 8:22049060-22049082 GCCCCCGGAGGGGCCGGGGCCGG + Intronic
1045488621 8:102654214-102654236 GCCCCCGCCCGCGCCCGACCCGG + Intronic
1046871352 8:119208573-119208595 GCAGACGAAGGCGCCCGAGTAGG - Exonic
1059414729 9:114155797-114155819 GCGCCCAGGGGCGCCCGAGCAGG - Exonic
1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG + Intronic
1062468657 9:136692522-136692544 GCCCCTGTAGGCGCCAGAGCCGG - Intergenic
1185894149 X:3843464-3843486 CCCCATGAAGGCGCCCGGGCTGG - Exonic
1185899268 X:3881888-3881910 CCCCATGAAGGCGCCCGGGCTGG - Intergenic
1185904385 X:3920317-3920339 CCCCATGAAGGCGCCCGGGCTGG - Intergenic
1188245313 X:27830842-27830864 GCCCCCCAAGGAGACTGAGCCGG + Intergenic