ID: 987394007

View in Genome Browser
Species Human (GRCh38)
Location 5:17403897-17403919
Sequence CAGACTGCACAGATGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987393999_987394007 30 Left 987393999 5:17403844-17403866 CCCAGGAGTTATATAAAGGATAT No data
Right 987394007 5:17403897-17403919 CAGACTGCACAGATGGAACATGG No data
987394005_987394007 -1 Left 987394005 5:17403875-17403897 CCGGAAGAAGGAGCGAATAAAGC No data
Right 987394007 5:17403897-17403919 CAGACTGCACAGATGGAACATGG No data
987394000_987394007 29 Left 987394000 5:17403845-17403867 CCAGGAGTTATATAAAGGATATT No data
Right 987394007 5:17403897-17403919 CAGACTGCACAGATGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987394007 Original CRISPR CAGACTGCACAGATGGAACA TGG Intergenic
No off target data available for this crispr