ID: 987394205

View in Genome Browser
Species Human (GRCh38)
Location 5:17406426-17406448
Sequence GGCAGAATTGCATTCATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987394205_987394209 0 Left 987394205 5:17406426-17406448 CCTGCCATGAATGCAATTCTGCC No data
Right 987394209 5:17406449-17406471 AGAGAATGATTGTGGCTCTGTGG No data
987394205_987394207 -8 Left 987394205 5:17406426-17406448 CCTGCCATGAATGCAATTCTGCC No data
Right 987394207 5:17406441-17406463 ATTCTGCCAGAGAATGATTGTGG No data
987394205_987394210 12 Left 987394205 5:17406426-17406448 CCTGCCATGAATGCAATTCTGCC No data
Right 987394210 5:17406461-17406483 TGGCTCTGTGGCAGCTATCTTGG No data
987394205_987394211 26 Left 987394205 5:17406426-17406448 CCTGCCATGAATGCAATTCTGCC No data
Right 987394211 5:17406475-17406497 CTATCTTGGTCTAGCCCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987394205 Original CRISPR GGCAGAATTGCATTCATGGC AGG (reversed) Intergenic
No off target data available for this crispr