ID: 987394207

View in Genome Browser
Species Human (GRCh38)
Location 5:17406441-17406463
Sequence ATTCTGCCAGAGAATGATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987394199_987394207 18 Left 987394199 5:17406400-17406422 CCTGGTTCAGCCCCTCGCCCTAT No data
Right 987394207 5:17406441-17406463 ATTCTGCCAGAGAATGATTGTGG No data
987394204_987394207 0 Left 987394204 5:17406418-17406440 CCTATTTTCCTGCCATGAATGCA No data
Right 987394207 5:17406441-17406463 ATTCTGCCAGAGAATGATTGTGG No data
987394205_987394207 -8 Left 987394205 5:17406426-17406448 CCTGCCATGAATGCAATTCTGCC No data
Right 987394207 5:17406441-17406463 ATTCTGCCAGAGAATGATTGTGG No data
987394198_987394207 19 Left 987394198 5:17406399-17406421 CCCTGGTTCAGCCCCTCGCCCTA No data
Right 987394207 5:17406441-17406463 ATTCTGCCAGAGAATGATTGTGG No data
987394201_987394207 7 Left 987394201 5:17406411-17406433 CCCTCGCCCTATTTTCCTGCCAT No data
Right 987394207 5:17406441-17406463 ATTCTGCCAGAGAATGATTGTGG No data
987394203_987394207 1 Left 987394203 5:17406417-17406439 CCCTATTTTCCTGCCATGAATGC No data
Right 987394207 5:17406441-17406463 ATTCTGCCAGAGAATGATTGTGG No data
987394200_987394207 8 Left 987394200 5:17406410-17406432 CCCCTCGCCCTATTTTCCTGCCA No data
Right 987394207 5:17406441-17406463 ATTCTGCCAGAGAATGATTGTGG No data
987394202_987394207 6 Left 987394202 5:17406412-17406434 CCTCGCCCTATTTTCCTGCCATG No data
Right 987394207 5:17406441-17406463 ATTCTGCCAGAGAATGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987394207 Original CRISPR ATTCTGCCAGAGAATGATTG TGG Intergenic
No off target data available for this crispr