ID: 987394209

View in Genome Browser
Species Human (GRCh38)
Location 5:17406449-17406471
Sequence AGAGAATGATTGTGGCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987394199_987394209 26 Left 987394199 5:17406400-17406422 CCTGGTTCAGCCCCTCGCCCTAT No data
Right 987394209 5:17406449-17406471 AGAGAATGATTGTGGCTCTGTGG No data
987394205_987394209 0 Left 987394205 5:17406426-17406448 CCTGCCATGAATGCAATTCTGCC No data
Right 987394209 5:17406449-17406471 AGAGAATGATTGTGGCTCTGTGG No data
987394206_987394209 -4 Left 987394206 5:17406430-17406452 CCATGAATGCAATTCTGCCAGAG No data
Right 987394209 5:17406449-17406471 AGAGAATGATTGTGGCTCTGTGG No data
987394203_987394209 9 Left 987394203 5:17406417-17406439 CCCTATTTTCCTGCCATGAATGC No data
Right 987394209 5:17406449-17406471 AGAGAATGATTGTGGCTCTGTGG No data
987394202_987394209 14 Left 987394202 5:17406412-17406434 CCTCGCCCTATTTTCCTGCCATG No data
Right 987394209 5:17406449-17406471 AGAGAATGATTGTGGCTCTGTGG No data
987394201_987394209 15 Left 987394201 5:17406411-17406433 CCCTCGCCCTATTTTCCTGCCAT No data
Right 987394209 5:17406449-17406471 AGAGAATGATTGTGGCTCTGTGG No data
987394204_987394209 8 Left 987394204 5:17406418-17406440 CCTATTTTCCTGCCATGAATGCA No data
Right 987394209 5:17406449-17406471 AGAGAATGATTGTGGCTCTGTGG No data
987394198_987394209 27 Left 987394198 5:17406399-17406421 CCCTGGTTCAGCCCCTCGCCCTA No data
Right 987394209 5:17406449-17406471 AGAGAATGATTGTGGCTCTGTGG No data
987394200_987394209 16 Left 987394200 5:17406410-17406432 CCCCTCGCCCTATTTTCCTGCCA No data
Right 987394209 5:17406449-17406471 AGAGAATGATTGTGGCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987394209 Original CRISPR AGAGAATGATTGTGGCTCTG TGG Intergenic
No off target data available for this crispr