ID: 987394210

View in Genome Browser
Species Human (GRCh38)
Location 5:17406461-17406483
Sequence TGGCTCTGTGGCAGCTATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987394202_987394210 26 Left 987394202 5:17406412-17406434 CCTCGCCCTATTTTCCTGCCATG No data
Right 987394210 5:17406461-17406483 TGGCTCTGTGGCAGCTATCTTGG No data
987394200_987394210 28 Left 987394200 5:17406410-17406432 CCCCTCGCCCTATTTTCCTGCCA No data
Right 987394210 5:17406461-17406483 TGGCTCTGTGGCAGCTATCTTGG No data
987394203_987394210 21 Left 987394203 5:17406417-17406439 CCCTATTTTCCTGCCATGAATGC No data
Right 987394210 5:17406461-17406483 TGGCTCTGTGGCAGCTATCTTGG No data
987394208_987394210 -9 Left 987394208 5:17406447-17406469 CCAGAGAATGATTGTGGCTCTGT No data
Right 987394210 5:17406461-17406483 TGGCTCTGTGGCAGCTATCTTGG No data
987394205_987394210 12 Left 987394205 5:17406426-17406448 CCTGCCATGAATGCAATTCTGCC No data
Right 987394210 5:17406461-17406483 TGGCTCTGTGGCAGCTATCTTGG No data
987394206_987394210 8 Left 987394206 5:17406430-17406452 CCATGAATGCAATTCTGCCAGAG No data
Right 987394210 5:17406461-17406483 TGGCTCTGTGGCAGCTATCTTGG No data
987394204_987394210 20 Left 987394204 5:17406418-17406440 CCTATTTTCCTGCCATGAATGCA No data
Right 987394210 5:17406461-17406483 TGGCTCTGTGGCAGCTATCTTGG No data
987394201_987394210 27 Left 987394201 5:17406411-17406433 CCCTCGCCCTATTTTCCTGCCAT No data
Right 987394210 5:17406461-17406483 TGGCTCTGTGGCAGCTATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987394210 Original CRISPR TGGCTCTGTGGCAGCTATCT TGG Intergenic
No off target data available for this crispr