ID: 987394211

View in Genome Browser
Species Human (GRCh38)
Location 5:17406475-17406497
Sequence CTATCTTGGTCTAGCCCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987394205_987394211 26 Left 987394205 5:17406426-17406448 CCTGCCATGAATGCAATTCTGCC No data
Right 987394211 5:17406475-17406497 CTATCTTGGTCTAGCCCATAAGG No data
987394206_987394211 22 Left 987394206 5:17406430-17406452 CCATGAATGCAATTCTGCCAGAG No data
Right 987394211 5:17406475-17406497 CTATCTTGGTCTAGCCCATAAGG No data
987394208_987394211 5 Left 987394208 5:17406447-17406469 CCAGAGAATGATTGTGGCTCTGT No data
Right 987394211 5:17406475-17406497 CTATCTTGGTCTAGCCCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987394211 Original CRISPR CTATCTTGGTCTAGCCCATA AGG Intergenic
No off target data available for this crispr