ID: 987394972

View in Genome Browser
Species Human (GRCh38)
Location 5:17414274-17414296
Sequence CACAGGACACTGAGAGCGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987394972_987394976 12 Left 987394972 5:17414274-17414296 CCTCTCGCTCTCAGTGTCCTGTG No data
Right 987394976 5:17414309-17414331 TTGATCTATGAGGCAATGTGTGG No data
987394972_987394974 2 Left 987394972 5:17414274-17414296 CCTCTCGCTCTCAGTGTCCTGTG No data
Right 987394974 5:17414299-17414321 GCCAAACTGATTGATCTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987394972 Original CRISPR CACAGGACACTGAGAGCGAG AGG (reversed) Intergenic
No off target data available for this crispr