ID: 987405773

View in Genome Browser
Species Human (GRCh38)
Location 5:17522139-17522161
Sequence GTGCTCTCGGGAACGCTGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987405773_987405779 -2 Left 987405773 5:17522139-17522161 CCGGTCAGCGTTCCCGAGAGCAC No data
Right 987405779 5:17522160-17522182 ACGCGTTGCGGGTCTGATGCGGG No data
987405773_987405778 -3 Left 987405773 5:17522139-17522161 CCGGTCAGCGTTCCCGAGAGCAC No data
Right 987405778 5:17522159-17522181 CACGCGTTGCGGGTCTGATGCGG No data
987405773_987405782 22 Left 987405773 5:17522139-17522161 CCGGTCAGCGTTCCCGAGAGCAC No data
Right 987405782 5:17522184-17522206 TATCACTGGCAGTTCGGTGTCGG No data
987405773_987405780 8 Left 987405773 5:17522139-17522161 CCGGTCAGCGTTCCCGAGAGCAC No data
Right 987405780 5:17522170-17522192 GGTCTGATGCGGGCTATCACTGG No data
987405773_987405781 16 Left 987405773 5:17522139-17522161 CCGGTCAGCGTTCCCGAGAGCAC No data
Right 987405781 5:17522178-17522200 GCGGGCTATCACTGGCAGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987405773 Original CRISPR GTGCTCTCGGGAACGCTGAC CGG (reversed) Intergenic