ID: 987405776

View in Genome Browser
Species Human (GRCh38)
Location 5:17522151-17522173
Sequence GACCCGCAACGCGTGCTCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987405776_987405781 4 Left 987405776 5:17522151-17522173 CCCGAGAGCACGCGTTGCGGGTC No data
Right 987405781 5:17522178-17522200 GCGGGCTATCACTGGCAGTTCGG No data
987405776_987405783 19 Left 987405776 5:17522151-17522173 CCCGAGAGCACGCGTTGCGGGTC No data
Right 987405783 5:17522193-17522215 CAGTTCGGTGTCGGAGAACGCGG No data
987405776_987405780 -4 Left 987405776 5:17522151-17522173 CCCGAGAGCACGCGTTGCGGGTC No data
Right 987405780 5:17522170-17522192 GGTCTGATGCGGGCTATCACTGG No data
987405776_987405782 10 Left 987405776 5:17522151-17522173 CCCGAGAGCACGCGTTGCGGGTC No data
Right 987405782 5:17522184-17522206 TATCACTGGCAGTTCGGTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987405776 Original CRISPR GACCCGCAACGCGTGCTCTC GGG (reversed) Intergenic