ID: 987405777

View in Genome Browser
Species Human (GRCh38)
Location 5:17522152-17522174
Sequence AGACCCGCAACGCGTGCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987405777_987405783 18 Left 987405777 5:17522152-17522174 CCGAGAGCACGCGTTGCGGGTCT No data
Right 987405783 5:17522193-17522215 CAGTTCGGTGTCGGAGAACGCGG No data
987405777_987405784 30 Left 987405777 5:17522152-17522174 CCGAGAGCACGCGTTGCGGGTCT No data
Right 987405784 5:17522205-17522227 GGAGAACGCGGCCATTGCCATGG No data
987405777_987405782 9 Left 987405777 5:17522152-17522174 CCGAGAGCACGCGTTGCGGGTCT No data
Right 987405782 5:17522184-17522206 TATCACTGGCAGTTCGGTGTCGG No data
987405777_987405780 -5 Left 987405777 5:17522152-17522174 CCGAGAGCACGCGTTGCGGGTCT No data
Right 987405780 5:17522170-17522192 GGTCTGATGCGGGCTATCACTGG No data
987405777_987405781 3 Left 987405777 5:17522152-17522174 CCGAGAGCACGCGTTGCGGGTCT No data
Right 987405781 5:17522178-17522200 GCGGGCTATCACTGGCAGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987405777 Original CRISPR AGACCCGCAACGCGTGCTCT CGG (reversed) Intergenic