ID: 987405780

View in Genome Browser
Species Human (GRCh38)
Location 5:17522170-17522192
Sequence GGTCTGATGCGGGCTATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987405770_987405780 27 Left 987405770 5:17522120-17522142 CCCGCTACGAAGTGTGTCGCCGG No data
Right 987405780 5:17522170-17522192 GGTCTGATGCGGGCTATCACTGG No data
987405773_987405780 8 Left 987405773 5:17522139-17522161 CCGGTCAGCGTTCCCGAGAGCAC No data
Right 987405780 5:17522170-17522192 GGTCTGATGCGGGCTATCACTGG No data
987405777_987405780 -5 Left 987405777 5:17522152-17522174 CCGAGAGCACGCGTTGCGGGTCT No data
Right 987405780 5:17522170-17522192 GGTCTGATGCGGGCTATCACTGG No data
987405772_987405780 26 Left 987405772 5:17522121-17522143 CCGCTACGAAGTGTGTCGCCGGT No data
Right 987405780 5:17522170-17522192 GGTCTGATGCGGGCTATCACTGG No data
987405776_987405780 -4 Left 987405776 5:17522151-17522173 CCCGAGAGCACGCGTTGCGGGTC No data
Right 987405780 5:17522170-17522192 GGTCTGATGCGGGCTATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987405780 Original CRISPR GGTCTGATGCGGGCTATCAC TGG Intergenic