ID: 987405782

View in Genome Browser
Species Human (GRCh38)
Location 5:17522184-17522206
Sequence TATCACTGGCAGTTCGGTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987405777_987405782 9 Left 987405777 5:17522152-17522174 CCGAGAGCACGCGTTGCGGGTCT No data
Right 987405782 5:17522184-17522206 TATCACTGGCAGTTCGGTGTCGG No data
987405776_987405782 10 Left 987405776 5:17522151-17522173 CCCGAGAGCACGCGTTGCGGGTC No data
Right 987405782 5:17522184-17522206 TATCACTGGCAGTTCGGTGTCGG No data
987405773_987405782 22 Left 987405773 5:17522139-17522161 CCGGTCAGCGTTCCCGAGAGCAC No data
Right 987405782 5:17522184-17522206 TATCACTGGCAGTTCGGTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987405782 Original CRISPR TATCACTGGCAGTTCGGTGT CGG Intergenic