ID: 987405783

View in Genome Browser
Species Human (GRCh38)
Location 5:17522193-17522215
Sequence CAGTTCGGTGTCGGAGAACG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987405777_987405783 18 Left 987405777 5:17522152-17522174 CCGAGAGCACGCGTTGCGGGTCT No data
Right 987405783 5:17522193-17522215 CAGTTCGGTGTCGGAGAACGCGG No data
987405776_987405783 19 Left 987405776 5:17522151-17522173 CCCGAGAGCACGCGTTGCGGGTC No data
Right 987405783 5:17522193-17522215 CAGTTCGGTGTCGGAGAACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987405783 Original CRISPR CAGTTCGGTGTCGGAGAACG CGG Intergenic