ID: 987406223

View in Genome Browser
Species Human (GRCh38)
Location 5:17525585-17525607
Sequence GACCCGCAACGCGTGCTCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987406223_987406229 10 Left 987406223 5:17525585-17525607 CCCGAGAGCACGCGTTGCGGGTC No data
Right 987406229 5:17525618-17525640 TATCACTGGCAGTTCGGTGTCGG No data
987406223_987406230 19 Left 987406223 5:17525585-17525607 CCCGAGAGCACGCGTTGCGGGTC No data
Right 987406230 5:17525627-17525649 CAGTTCGGTGTCGGAGAACGCGG No data
987406223_987406228 4 Left 987406223 5:17525585-17525607 CCCGAGAGCACGCGTTGCGGGTC No data
Right 987406228 5:17525612-17525634 GCGGGCTATCACTGGCAGTTCGG No data
987406223_987406227 -4 Left 987406223 5:17525585-17525607 CCCGAGAGCACGCGTTGCGGGTC No data
Right 987406227 5:17525604-17525626 GGTCTGATGCGGGCTATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987406223 Original CRISPR GACCCGCAACGCGTGCTCTC GGG (reversed) Intergenic