ID: 987406669

View in Genome Browser
Species Human (GRCh38)
Location 5:17529019-17529041
Sequence GACCCGCAACGCGTGCTCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987406669_987406674 4 Left 987406669 5:17529019-17529041 CCCGAGAGCACGCGTTGCGGGTC No data
Right 987406674 5:17529046-17529068 GCGGGCTATCACTGGCAGTTCGG No data
987406669_987406673 -4 Left 987406669 5:17529019-17529041 CCCGAGAGCACGCGTTGCGGGTC No data
Right 987406673 5:17529038-17529060 GGTCTGATGCGGGCTATCACTGG No data
987406669_987406675 10 Left 987406669 5:17529019-17529041 CCCGAGAGCACGCGTTGCGGGTC No data
Right 987406675 5:17529052-17529074 TATCACTGGCAGTTCGGTGTCGG No data
987406669_987406676 19 Left 987406669 5:17529019-17529041 CCCGAGAGCACGCGTTGCGGGTC No data
Right 987406676 5:17529061-17529083 CAGTTCGGTGTCGGAGAACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987406669 Original CRISPR GACCCGCAACGCGTGCTCTC GGG (reversed) Intergenic