ID: 987407476

View in Genome Browser
Species Human (GRCh38)
Location 5:17585386-17585408
Sequence GACCCGCAACGCGTGCTCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987407471_987407476 4 Left 987407471 5:17585359-17585381 CCGAACTGCCAGTGATAGCCCGC No data
Right 987407476 5:17585386-17585408 GACCCGCAACGCGTGCTCTCGGG No data
987407469_987407476 19 Left 987407469 5:17585344-17585366 CCGCGTTCTCCGACACCGAACTG No data
Right 987407476 5:17585386-17585408 GACCCGCAACGCGTGCTCTCGGG No data
987407472_987407476 -4 Left 987407472 5:17585367-17585389 CCAGTGATAGCCCGCATCAGACC No data
Right 987407476 5:17585386-17585408 GACCCGCAACGCGTGCTCTCGGG No data
987407470_987407476 10 Left 987407470 5:17585353-17585375 CCGACACCGAACTGCCAGTGATA No data
Right 987407476 5:17585386-17585408 GACCCGCAACGCGTGCTCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987407476 Original CRISPR GACCCGCAACGCGTGCTCTC GGG Intergenic