ID: 987408175

View in Genome Browser
Species Human (GRCh38)
Location 5:17590588-17590610
Sequence GACCCGCAACGCGTGCTCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987408168_987408175 19 Left 987408168 5:17590546-17590568 CCGCGTTCTCCGACACCGAACTG No data
Right 987408175 5:17590588-17590610 GACCCGCAACGCGTGCTCTCGGG No data
987408169_987408175 10 Left 987408169 5:17590555-17590577 CCGACACCGAACTGCCAGTGATA No data
Right 987408175 5:17590588-17590610 GACCCGCAACGCGTGCTCTCGGG No data
987408171_987408175 -4 Left 987408171 5:17590569-17590591 CCAGTGATAGCCCGCATCAGACC No data
Right 987408175 5:17590588-17590610 GACCCGCAACGCGTGCTCTCGGG No data
987408170_987408175 4 Left 987408170 5:17590561-17590583 CCGAACTGCCAGTGATAGCCCGC No data
Right 987408175 5:17590588-17590610 GACCCGCAACGCGTGCTCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987408175 Original CRISPR GACCCGCAACGCGTGCTCTC GGG Intergenic