ID: 987408622

View in Genome Browser
Species Human (GRCh38)
Location 5:17594022-17594044
Sequence GACCCGCAACGCGTGCTCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987408616_987408622 10 Left 987408616 5:17593989-17594011 CCGACACCGAACTGCCAGTGATA No data
Right 987408622 5:17594022-17594044 GACCCGCAACGCGTGCTCTCGGG No data
987408617_987408622 4 Left 987408617 5:17593995-17594017 CCGAACTGCCAGTGATAGCCCGC No data
Right 987408622 5:17594022-17594044 GACCCGCAACGCGTGCTCTCGGG No data
987408618_987408622 -4 Left 987408618 5:17594003-17594025 CCAGTGATAGCCCGCATCAGACC No data
Right 987408622 5:17594022-17594044 GACCCGCAACGCGTGCTCTCGGG No data
987408615_987408622 19 Left 987408615 5:17593980-17594002 CCGCGTTCTCCGACACCGAACTG No data
Right 987408622 5:17594022-17594044 GACCCGCAACGCGTGCTCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987408622 Original CRISPR GACCCGCAACGCGTGCTCTC GGG Intergenic